Skip to content

DriverMap Adaptive Immune Receptor (AIR) TCR-BCR Profiling

Cellecta’s DriverMapβ„’ AIR TCR-BCR assay is designed to specifically amplify only functional CDR3 RNA molecules' TCR and BCR cells, avoiding non-functional pseudogenes with similar structures. The assay simultaneously amplifies, in a single, multiplex RT-PCR reaction, all TCR and BCR CDR3 regions using a set of 300 experimentally validated PCR primers to yield Illumina-compatible, next-generation sequencing (NGS) libraries.

Bellow you can see the structure of cDNA library.

The data for this tutorial consists of three samples. Total RNA was isolated from human PBMC. cDNA libraries were prepared for each sample from 50ng of RNA according to Cellecta’s DriverMapβ„’ AIR TCR-BCR assay protocol for all IGH chain. Sequencing was performed on an Illumina NextSeq500 sequencer paired-end 2x150 bp reads.

All data may be downloaded using the script bellow.

Use aria2c for efficient download of the full dataset with the proper filenames:

download.sh
mkdir -p raw
aria2c -c -s 16 -x 16 -k 1M -j 8 -i download-list.txt
download-list.txt
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR220/006/SRR22058606/SRR22058606_1.fastq.gz
  out=raw/Sample1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR220/006/SRR22058606/SRR22058606_2.fastq.gz
  out=raw/Sample1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR220/004/SRR22058604/SRR22058604_1.fastq.gz
  out=raw/Sample2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR220/004/SRR22058604/SRR22058604_2.fastq.gz
  out=raw/Sample2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR220/005/SRR22058605/SRR22058605_1.fastq.gz
  out=raw/Sample3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/SRR220/005/SRR22058605/SRR22058605_2.fastq.gz
  out=raw/Sample3_R2.fastq.gz

Upstream analysis

One-line solution

MiXCR has a dedicated preset for this protocol, thus analysing the data is as easy as:

mixcr analyze cellecta-human-rna-xcr-umi-drivermap-air \
    raw/Sample1_R1.fastq.gz \
    raw/Sample1_1_R2.fastq.gz \
    results/Sample1

Running the command above will generate the following files:

> ls result/

# human-readable reports 
Sample1.align.report.txt
Sample1.align.report.json
Sample1.refine.report.txt
Sample1.refine.report.json
Sample1.assemble.report.txt
Sample1.assemle.report.json

# raw alignments (highly compressed binary file)
Sample1.vdjca

#Alignments with corrected barcode after ```mixcr refineTagsAndSort```
Sample1.refined.vdjca

# TCR and BCR CDR3 clonotypes (highly compressed binary file)
Sample1.clns

# TCR and BCR CDR3 clonotypes exported in tab-delimited txt
Sample1.clones_IGH.tsv
Sample1.clones_IGK.tsv
Sample1.clones_IGL.tsv
Sample1.clones_TRAD.tsv
Sample1.clones_TRB.tsv

While .clns file holds all data and is used for downstream analysis using mixcr postanalisis, the output .txt clonotype table will contain exhaustive information about each clonotype as well:

See first 500 records from Sample1.clones_IGH.tsv clonotype table
cloneId readCount readFraction uniqueUMICount uniqueUMIFraction targetSequences targetQualities allVHitsWithScore allDHitsWithScore allJHitsWithScore allCHitsWithScore allVAlignments allDAlignments allJAlignments allCAlignments nSeqCDR3 minQualCDR3 aaSeqCDR3 refPoints
27 8743 0.00528084 909 0.00539805 TGTGCGAGGGCGCTTAGTGGGAAAACACTCACTTTTGCCTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-5900(476.6),IGHV4-6100(474.5) IGHD1-26*00(40) IGHJ4*00(336.6) IGHM*00(139.5) 439|447|470|0|8||80.0;445|453|476|0|8||80.0 24|32|60|14|22||40.0 25|37|68|33|45|SA29CSA32T|62.0 nan TGTGCGAGGGCGCTTAGTGGGAAAACACTCACTTTTGCCTTCTGG 45 CARALSGKTLTFAFW :::::::::0:-3:8:14:-4:-8:22:33:-5:45:::
89 3470 0.00209591 350 0.00207846 TGTACGAGGGCGGGATCTTATAGACATGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(735.8) IGHD7-2700(30),IGHD3-1600(28),IGHD2-15*00(27) IGHJ4*00(254.7) nan 442|445|473|0|3||30.0 18|24|33|11|17||30.0;63|72|111|14|22|DG66|28.0;32|43|93|12|23|SA36CSG39A|27.0 27|37|68|26|36||100.0 nan TGTACGAGGGCGGGATCTTATAGACATGACTACTGG 45 CTRAGSYRHDYW :::::::::0:-8:3:11:-7:2:17:26:-7:36:::
109 2851 0.00172202 266 0.00157963 TGTGCGAGAGAAAGAATGGGGCGAACGATTTTTGGGTCGCGTGCAATTGACTACAAGTTCATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-4*00(422) IGHD3-3*00(55) IGHJ6*00(307.9) nan 442|453|473|0|11||110.0 36|47|93|24|35||55.0 40|52|83|60|72||120.0 nan TGTGCGAGAGAAAGAATGGGGCGAACGATTTTTGGGTCGCGTGCAATTGACTACAAGTTCATGGACGTCTGG 45 CARERMGRTIFGSRAIDYKFMDVW :::::::::0:0:11:24:-5:-15:35:60:-20:72:::
122 2543 0.00153599 263 0.00156181 TGTGCGACCCGGGGGTGGATACAGCTATGGTTACCGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(526.7) IGHD5-5*00(100) IGHJ4*00(376.4) IGHM*00(131.9) 442|449|473|0|7||70.0 20|40|60|14|34||100.0 28|37|68|36|45||90.0 nan TGTGCGACCCGGGGGTGGATACAGCTATGGTTACCGGACTACTGG 45 CATRGWIQLWLPDYW :::::::::0:-4:7:14:0:0:34:36:-8:45:::
133 2382 0.00143875 247 0.0014668 TGTGCGACCCGGGGGTGGATACAGCTATGGTTACCGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(910.9) IGHD5-5*00(100) IGHJ4*00(179.5) nan 442|449|473|0|7||70.0 20|40|60|14|34||100.0 28|37|68|36|45||90.0 nan TGTGCGACCCGGGGGTGGATACAGCTATGGTTACCGGACTACTGG 45 CATRGWIQLWLPDYW :::::::::0:-4:7:14:0:0:34:36:-8:45:::
142 2228 0.00134573 225 0.00133615 TGTGCGAGATCCTTGACTACGGAGACTACCCGCCACTTTGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(912.4),IGHV3-700(912.4) IGHD4-17*00(66) IGHJ4*00(178.9) nan 442|451|473|0|9||90.0;442|451|473|0|9||90.0 16|32|48|13|29|ST25A|66.0 23|37|68|34|48|SA32T|111.0 nan TGTGCGAGATCCTTGACTACGGAGACTACCCGCCACTTTGACTTCTGG 45 CARSLTTETTRHFDFW :::::::::0:-2:9:13:0:0:29:34:-3:48:::
171 2016 0.00121768 218 0.00129458 TGTGCGAGTAGAGCGTGGATCCAGCTATGGTTACCCGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(481.7) IGHD5-5*00(91) IGHJ4*00(337.5) IGHM*00(132.5) 442|449|473|0|7||70.0 19|40|60|13|34|SA26C|91.0 28|37|68|36|45|SA32T|61.0 nan TGTGCGAGTAGAGCGTGGATCCAGCTATGGTTACCCGACTTCTGG 45 CASRAWIQLWLPDFW :::::::::0:-4:7:13:1:0:34:36:-8:45:::
189 1851 0.00111802 175 0.00103923 TGTGCGAAAGGGATCAGTTACTACTACGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(557.9) IGHD7-27*00(25) IGHJ6*00(512.6) IGHM*00(146.9) 442|452|473|0|10||100.0 19|24|33|10|15||25.0 28|52|83|18|42||240.0 nan TGTGCGAAAGGGATCAGTTACTACTACGGTATGGACGTCTGG 45 CAKGISYYYGMDVW :::::::::0:-1:10:10:-8:2:15:18:-8:42:::
228 1593 0.000962184 151 0.000896707 TGTGCGACAGTGAATGATGTGGCAGTGGCTCCTTTTGACGACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-4*00(300.5) IGHD6-19*00(45) IGHJ4*00(366.2) IGHA100(140.2),IGHA200(140.2) 442|452|473|0|10|SG449C|71.0 28|37|63|21|30||45.0 25|37|68|33|45|ST31G|91.0 ; TGTGCGACAGTGAATGATGTGGCAGTGGCTCCTTTTGACGACTGG 45 CATVNDVAVAPFDDW :::::::::0:-1:10:21:-7:-5:30:33:-5:45:::
234 1551 0.000936815 155 0.00092046 TGTGCGCGAGAGGTAAAAGCAGCAGGTGACAGTGATGCTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-31*00(448.9) IGHD6-1300(41),IGHD2-200(36) IGHJ3*00(460.9) IGHA100(111.5),IGHA200(111.5) 445|456|476|0|11|SA451C|81.0 27|38|63|17|28|SC35G|41.0;5|15|93|17|27|ST11A|36.0 20|39|70|32|51||190.0 ; TGTGCGCGAGAGGTAAAAGCAGCAGGTGACAGTGATGCTTTTGATATCTGG 45 CAREVKAAGDSDAFDIW :::::::::0:0:11:17:-6:-4:28:32:0:51:::
238 1532 0.000925339 156 0.000926399 TGTGTAAAAGGTAGCTCTGGTTACGGGGTCTTTGAGTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(763.2) IGHD5-5*00(51) IGHJ4*00(76.6) nan 442|452|473|0|10|SC446TSG449A|42.0 28|41|60|12|25|SA32C|51.0 24|37|68|29|42|SC30GSA32C|72.0 nan TGTGTAAAAGGTAGCTCTGGTTACGGGGTCTTTGAGTCCTGG 45 CVKGSSGYGVFESW :::::::::0:-1:10:12:-8:1:25:29:-4:42:::
242 1529 0.000923527 170 0.00100954 TGTGCGAGAGGCTGGCGTTACTGG NNNNNNNNNNNNNNNNNNNNNNNN IGHV3-11*00(585.2) IGHD2-200(25),IGHD6-1300(25),IGHD6-19*00(25) IGHJ4*00(264.6) nan 442|452|473|0|10||100.0 9|14|93|10|15||25.0;34|39|63|10|15||25.0;34|39|63|10|15||25.0 31|37|68|18|24||60.0 nan TGTGCGAGAGGCTGGCGTTACTGG 45 CARGWRYW :::::::::0:-1:10:10:22:-48:15:18:-11:24:::
259 1425 0.00086071 148 0.000878891 TGTGCGAAAGGGATCAGTTACTACTACGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(956.5) IGHD7-27*00(25) IGHJ6*00(349.6) nan 442|452|473|0|10||100.0 19|24|33|10|15||25.0 28|52|83|18|42||240.0 nan TGTGCGAAAGGGATCAGTTACTACTACGGTATGGACGTCTGG 45 CAKGISYYYGMDVW :::::::::0:-1:10:10:-8:2:15:18:-8:42:::
261 1417 0.000855878 135 0.000801691 TGTGCACGGACCGCCTACTACTACTACCACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-26*00(464.4) nan IGHJ6*00(433.6) IGHA100(157.6),IGHA200(157.6) 445|455|478|0|10||100.0 nan 24|52|83|14|42|SG37CSG38AST39C|193.0 ; TGTGCACGGACCGCCTACTACTACTACCACATGGACGTCTGG 45 CARTAYYYYHMDVW :::::::::0:-3:10:::::14:-4:42:::
263 1414 0.000854066 155 0.00092046 TGTGCGAAAGGTGGTTACTGTGGTTCGGGGAGTTCTTATAATGAACGCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(463.9) IGHD3-10*00(93) IGHJ4*00(376.7) IGHM*00(88.6) 442|452|473|0|10||100.0 34|61|93|14|41|SA39GSA46GSA54C|93.0 30|37|68|47|54||70.0 nan TGTGCGAAAGGTGGTTACTGTGGTTCGGGGAGTTCTTATAATGAACGCTACTGG 45 CAKGGYCGSGSSYNERYW :::::::::0:-1:10:14:-3:-1:41:47:-10:54:::
266 1407 0.000849838 138 0.000819507 TGTGCGAGAGATAAAAGTGCGAAAGATAGTACTTGTCGTGGTACCAGCTGCTGGTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-46*00(235.3) IGHD2-200(72),IGHD6-1300(65) IGHJ5*00(429.9) nan 442|454|473|0|12||120.0 37|57|93|32|52|SA41CSA44G|72.0;0|13|63|40|53||65.0 25|40|71|54|69||150.0 nan TGTGCGAGAGATAAAAGTGCGAAAGATAGTACTTGTCGTGGTACCAGCTGCTGGTGGTTCGACCCCTGG 45 CARDKSAKDSTCRGTSCWWFDPW :::::::::0:1:12:32:-6:-5:52:54:-5:69:::
275 1373 0.000829302 135 0.000801691 TGTGCGAAAGATTTCATAGTGGCTATTGACTTCGGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(921.7) IGHD5-1200(50),IGHD5-1800(50) IGHJ4*00(228.8) nan 442|454|473|0|12||120.0 29|39|69|15|25||50.0;29|39|69|15|25||50.0 26|37|68|25|36|SA32TST34G|52.0 nan TGTGCGAAAGATTTCATAGTGGCTATTGACTTCGGG 45 CAKDFIVAIDFG :::::::::0:1:12:15:-6:-7:25:25:-6:36:::
288 1332 0.000804538 140 0.000831384 TGTGCGAGACGGGTCACGGTATTAGAGCCTCACTACTACCTGTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(343.9) IGHD1-2600(41),IGHD2-200(40),IGHD3-22*00(40) IGHJ6*00(379.6) IGHA100(76.8),IGHA200(76.8) 445|455|476|0|10||100.0 1|24|60|22|44|DT4DT8SC10TI16CSG20T|41.0;15|23|93|31|39||40.0;11|19|93|30|38||40.0 40|52|83|45|57||120.0 ; TGTGCGAGACGGGTCACGGTATTAGAGCCTCACTACTACCTGTACATGGACGTCTGG 45 CARRVTVLEPHYYLYMDVW :::::::::0:-1:10:22:19:-16:44:45:-20:57:::
294 1306 0.000788834 156 0.000926399 TGTGCGAGGGCGCTTAGTGGGAAAACACTCACTTTTGCCTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-5900(852),IGHV4-6100(852) IGHD1-26*00(40) IGHJ4*00(153.4) nan 439|447|470|0|8||80.0;445|453|476|0|8||80.0 24|32|60|14|22||40.0 25|37|68|33|45|SA29CSA32T|62.0 nan TGTGCGAGGGCGCTTAGTGGGAAAACACTCACTTTTGCCTTCTGG 45 CARALSGKTLTFAFW :::::::::0:-3:8:14:-4:-8:22:33:-5:45:::
318 1234 0.000745345 133 0.000789814 TGCCTAAAGTATTACTATGATTCGGGGAGTTACTGGTACTTCGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-15*00(383.1) IGHD3-1000(67),IGHD3-2200(65) IGHJ2*00(513.6) IGHM*00(103.7) 448|450|479|0|2||20.0 31|50|93|8|27|SG42ASA46G|67.0;31|44|93|8|21||65.0 18|42|73|27|51|SC20T|211.0 nan TGCCTAAAGTATTACTATGATTCGGGGAGTTACTGGTACTTCGATCTCTGG 45 CLKYYYDSGSYWYFDLW :::::::::0:-9:2:8:0:-12:27:27:2:51:::
323 1219 0.000736285 131 0.000777937 TGTGCGAAAGGTGGTTACTGTGGTTCGGGGACTTCTTATAGTGAACGCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(486.6) IGHD3-10*00(74) IGHJ4*00(377) IGHM*00(88.5) 442|452|473|0|10||100.0 34|60|93|14|40|SA39GSA46GSG51CSA54C|74.0 30|37|68|47|54||70.0 nan TGTGCGAAAGGTGGTTACTGTGGTTCGGGGACTTCTTATAGTGAACGCTACTGG 45 CAKGGYCGSGTSYSERYW :::::::::0:-1:10:14:-3:-2:40:47:-10:54:::
325 1211 0.000731453 115 0.000682922 TGTGCACGGACCGCCTACTACTACTACCACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-70*00(903.5) nan IGHJ6*00(258.5) nan 445|455|478|0|10||100.0 nan 24|52|83|14|42|SG37CSG38AST39C|193.0 nan TGTGCACGGACCGCCTACTACTACTACCACATGGACGTCTGG 45 CARTAYYYYHMDVW :::::::::0:-3:10:::::14:-4:42:::
336 1183 0.000714541 118 0.000700738 TGTGCGAAGATTATTGTCCCTAATCCTAGCTACTTCTTTAACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(453.8) IGHD5-1200(36),IGHD5-1800(36),IGHD2-15*00(35) IGHJ4*00(383.2) IGHM*00(117.8) 442|450|473|0|8||80.0 1|11|69|20|30|SG6C|36.0;1|11|69|20|30|SG6C|36.0;26|33|93|22|29||35.0 19|37|68|30|48|SA23TSG28ASA32C|93.0 nan TGTGCGAAGATTATTGTCCCTAATCCTAGCTACTTCTTTAACTCCTGG 45 CAKIIVPNPSYFFNSW :::::::::0:-3:8:20:22:-35:30:30:1:48:::
337 1175 0.000709709 109 0.000647291 TGTGCGAGACTGCAGTGGGAACTACTTCACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(879.2) IGHD1-26*00(51) IGHJ4*00(312) nan 442|452|473|0|10||100.0 25|38|60|13|26|SG32A|51.0 23|37|68|28|42||140.0 nan TGTGCGAGACTGCAGTGGGAACTACTTCACTTTGACTACTGG 45 CARLQWELLHFDYW :::::::::0:-1:10:13:-5:-2:26:28:-3:42:::
338 1174 0.000709105 117 0.000694799 TGTGCGAGAGAGGTGGGTTCAGCTGGTAAAGGAGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-4*00(386) IGHD2-200(45),IGHD6-1300(45) IGHJ4*00(342.9) IGHM*00(141.8) 442|453|473|0|11||110.0 7|16|93|19|28||45.0;32|41|63|19|28||45.0 28|37|68|33|42|SA32T|61.0 nan TGTGCGAGAGAGGTGGGTTCAGCTGGTAAAGGAGACTTCTGG 45 CAREVGSAGKGDFW :::::::::0:0:11:19:24:-46:28:33:-8:42:::
360 1107 0.000668636 120 0.000712614 TGTGCACGGGCCGGTTCGTATAGTGGCAGCTACTACCTTGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-70*00(816.8) IGHD1-2600(51),IGHD5-1200(45),IGHD5-18*00(45) IGHJ4*00(189.5) nan 445|454|478|0|9||90.0 21|34|60|17|30|SG30C|51.0;28|37|69|18|27||45.0;28|37|69|18|27||45.0 19|37|68|30|48|ST25CST31C|122.0 nan TGTGCACGGGCCGGTTCGTATAGTGGCAGCTACTACCTTGACCACTGG 45 CARAGSYSGSYYLDHW :::::::::0:-4:9:17πŸ‘Ž-6:30:30:1:48:::
391 1040 0.000628168 103 0.000611661 TGTGCGAGAGGAATTTTTTACGATTTTTGGAGTGGCGATTATACGAAGAATTACTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-18*00(561.3) IGHD3-3*00(107) IGHJ4*00(335.4) nan 442|452|473|0|10||100.0 34|61|93|17|44|ST52CST53G|107.0 13|37|68|45|69|ST16ASG18T|182.0 nan TGTGCGAGAGGAATTTTTTACGATTTTTGGAGTGGCGATTATACGAAGAATTACTACTTTGACTACTGG 45 CARGIFYDFWSGDYTKNYYFDYW :::::::::0:-1:10:17:-3:-1:44:45:7:69:::
403 1020 0.000616087 111 0.000659168 TGTGCGAAAAACTTTGGTTCGGGGACTTATTATAGGGGCGCTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(499.5) IGHD3-10*00(78) IGHJ3*00(404.5) IGHM*00(102.8) 442|451|473|0|9||90.0 36|60|93|10|34|SA39TSA46GSG51C|78.0 29|39|70|41|51||100.0 nan TGTGCGAAAAACTTTGGTTCGGGGACTTATTATAGGGGCGCTGATATCTGG 45 CAKNFGSGTYYRGADIW :::::::::0:-2:9:10:-5:-2:34:41:-9:51:::
412 989 0.000597363 102 0.000605722 TGTGCGAGGGATGGTCTATCGGCTCGCTCACGAGGGGGTAATTATTATCACTACTACATGGACCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(361.5) IGHD2-200(40),IGHD3-2200(40),IGHD3-10*00(37) IGHJ6*00(281.3) nan 442|454|473|0|12|SA450G|91.0 15|23|93|49|57||40.0;11|19|93|48|56||40.0;46|59|93|32|45|SA50GST53A|37.0 40|52|83|57|69|SG46C|91.0 nan TGTGCGAGGGATGGTCTATCGGCTCGCTCACGAGGGGGTAATTATTATCACTACTACATGGACCTCTGG 45 CARDGLSARSRGGNYYHYYMDLW :::::::::0:1:12:49:16:-39:57:57:-20:69:::
421 969 0.000585283 103 0.000611661 TGTGCGAAGATTATTGTCCCTAATCCTAGCTACTTCTTTAACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(773.8) IGHD5-1200(36),IGHD5-1800(36),IGHD2-15*00(35) IGHJ4*00(184.3) nan 442|450|473|0|8||80.0 1|11|69|20|30|SG6C|36.0;1|11|69|20|30|SG6C|36.0;26|33|93|22|29||35.0 19|37|68|30|48|SA23TSG28A|122.0 nan TGTGCGAAGATTATTGTCCCTAATCCTAGCTACTTCTTTAACTACTGG 45 CAKIIVPNPSYFFNYW :::::::::0:-3:8:20:22:-35:30:30:1:48:::
484 867 0.000523674 93 0.000552276 TGTGCGAGAGTAATCGATTATTCCTTTGGTTCGGGGTCCTTTGACCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-1100(226.4),IGHV3-2300(225.6) IGHD3-10*00(48) IGHJ400(362.2),IGHJ500(353.2) IGHA100(103.8),IGHA200(103.8) 442|452|473|0|10||100.0;442|452|473|0|10|SA449G|71.0 32|50|93|18|36|SA36CSA39TSA46G|48.0 24|37|68|38|51|ST31CSA32T|72.0;28|40|71|39|51|SC30TSC35T|62.0 ; TGTGCGAGAGTAATCGATTATTCCTTTGGTTCGGGGTCCTTTGACCTCTGG 45 CARVIDYSFGSGSFDLW :::::::::0:-1:10:18πŸ‘Ž-12:36:38:-4:51:::
541 789 0.000476562 83 0.000492892 TGTGCGAGGGGTCCGGATTACTATGATCGTAGTGGTCAAACAACCTACTATTACGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-1500(292.4),IGHV3-4900(292.4) IGHD3-22*00(87) IGHJ6*00(525.7) nan 448|451|479|0|3||30.0;448|451|479|0|3||30.0 30|53|93|13|36|ST32GSA44C|87.0 27|52|83|44|69|SC33T|221.0 nan TGTGCGAGGGGTCCGGATTACTATGATCGTAGTGGTCAAACAACCTACTATTACGGTATGGACGTCTGG 45 CARGPDYYDRSGQTTYYYGMDVW :::::::::0:-8:3:13:1:-9:36:44:-7:69:::
546 779 0.000470522 86 0.000510707 TGTGCGAGTGCATTGTTCTACTACATGGATGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-2*00(738.8) IGHD2-200(36),IGHD1-2600(35) IGHJ6*00(189.1) nan 442|450|473|0|8||80.0 13|23|93|14|24|SA15T|36.0;33|40|60|17|24||35.0 40|52|83|24|36|SC45T|91.0 nan TGTGCGAGTGCATTGTTCTACTACATGGATGTCTGG 45 CASALFYYMDVW :::::::::0:-3:8:14:18:-39:24:24:-20:36:::
552 772 0.000466294 81 0.000481015 TGTGGAAGAGATACGGGCGGTTCGTGGGGCCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(807.5) IGHD1-2600(29),IGHD3-1000(25),IGHD5-12*00(25) IGHJ500(213.8),IGHJ400(210.5) nan 442|454|473|0|12|SC446G|91.0 19|31|60|17|28|DA23SA25C|29.0;41|46|93|18|23||25.0;22|27|69|22|27||25.0 33|40|71|29|36|SC35T|41.0;33|37|68|32|36||40.0 nan TGTGGAAGAGATACGGGCGGTTCGTGGGGCCTCTGG 45 CGRDTGGSWGLW :::::::::0:1:12:17:1:-9:28:29:-13:36:::
575 734 0.000443341 76 0.000451322 TGTGTTCATCTCTACGGTAACTCGGACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(785.6),IGHV3-700(785.6) IGHD5-2400(50),IGHD4-1100(43),IGHD4-4*00(43) IGHJ4*00(290.1) nan 442|446|473|0|4||40.0;442|446|473|0|4||40.0 11|21|60|6|16||50.0;13|30|48|5|22|SG17CSA18TSA23G|43.0;13|30|48|5|22|SG17CSA18TSA23G|43.0 32|37|68|25|30||50.0 nan TGTGTTCATCTCTACGGTAACTCGGACTGG 45 CVHLYGNSDW :::::::::0:-7:4:6:9:-19:16:25:-12:30:::
586 727 0.000439113 76 0.000451322 TGTATGACAGATCCCTTTTCCTATGATACAATTGGGGGGGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-60*00(224.9) IGHD3-16*00(59) IGHJ400(304.7),IGHJ500(302.2) IGHG100(117.4),IGHG200(117.4),IGHG400(117.4),IGHGP00(115.9) 443|456|474|0|13|SG446ASA450C|72.0 41|59|111|21|38|DT46ST51A|59.0 28|37|68|39|48|SA32C|61.0;31|40|71|39|48|SC34T|61.0 ;;; TGTATGACAGATCCCTTTTCCTATGATACAATTGGGGGGGACTCCTGG 45 CMTDPFSYDTIGGDSW :::::::::0:2:13:21:-4:-15:38:39:-8:48:::
592 719 0.000434281 70 0.000415692 TGTGCGAAAGATTTCATAGTGGCTATTGACTTCGGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(559.4) IGHD5-1200(50),IGHD5-1800(50) IGHJ4*00(340.7) IGHM*00(176) 442|454|473|0|12||120.0 29|39|69|15|25||50.0;29|39|69|15|25||50.0 26|37|68|25|36|SA32TST34G|52.0 nan TGTGCGAAAGATTTCATAGTGGCTATTGACTTCGGG 45 CAKDFIVAIDFG :::::::::0:1:12:15:-6:-7:25:25:-6:36:::
618 698 0.000421597 75 0.000445384 TGTGCGAAAGATGGCCGGCTACGTTTGGGGGAGCCCCATGAGTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(538.5) IGHD3-16*00(56) IGHJ4*00(453.9) IGHM*00(74.6) 442|454|473|0|12||120.0 47|61|111|19|33|SA50G|56.0 22|37|68|42|57||150.0 nan TGTGCGAAAGATGGCCGGCTACGTTTGGGGGAGCCCCATGAGTACTTTGACTACTGG 45 CAKDGRLRLGEPHEYFDYW :::::::::0:1:12:19:-10:-13:33:42:-2:57:::
628 689 0.000416161 76 0.000451322 TGTGCGAGATGGACTTGGGGGCGGCTCGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(832.6) IGHD3-16*00(35) IGHJ5*00(235) nan 442|451|473|0|9||90.0 52|59|111|14|21||35.0 26|40|71|22|36|ST28CSC34T|82.0 nan TGTGCGAGATGGACTTGGGGGCGGCTCGACTCCTGG 45 CARWTWGRLDSW :::::::::0:-2:9:14:-15:-15:21:22:-6:36:::
632 686 0.000414349 70 0.000415692 TGTGCGAGAGTGATCGATGACTACGGTGGTAATCTAAATGCTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-1100(280.1),IGHV3-7100(280.1) IGHD4-23*00(80) IGHJ3*00(437) IGHA100(87.3),IGHA200(87.3) 442|452|473|0|10||100.0;448|458|479|0|10||100.0 18|34|57|16|32||80.0 22|39|70|37|54||170.0 ; TGTGCGAGAGTGATCGATGACTACGGTGGTAATCTAAATGCTTTTGATATCTGG 45 CARVIDDYGGNLNAFDIW :::::::::0:-1:10:16:1:-4:32:37:-2:54:::
644 675 0.000407705 64 0.000380061 TGTGCGGGGAGGAGACCCCTGGGGCCGTCTGACTTGTACTACTACTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-3*00(278) IGHD7-2700(30),IGHD4-1100(28),IGHD4-23*00(28) IGHJ6*00(431.9) nan 442|448|473|0|6||60.0 15|21|33|18|24||30.0;12|21|48|26|34|DA15|28.0;15|24|57|26|34|DA18|28.0 25|52|83|36|60|DG37DG38DT39|156.0 nan TGTGCGGGGAGGAGACCCCTGGGGCCGTCTGACTTGTACTACTACTACATGGACGTCTGG 45 CAGRRPLGPSDLYYYYMDVW :::::::::0:-5:6:18:-4:-1:24:36:-5:60:::
648 672 0.000405893 74 0.000439446 TGTATCACAGATCCCTTTTCCTATGATATTAGTGGAGGGGACTGCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-15*00(714.2) IGHD3-22*00(62) IGHJ4*00(152.1) nan 448|461|479|0|13|SC452T|101.0 34|52|93|17|35|SA36CSG45T|62.0 28|37|68|39|48|SA32G|61.0 nan TGTATCACAGATCCCTTTTCCTATGATATTAGTGGAGGGGACTGCTGG 45 CITDPFSYDISGGDCW :::::::::0:2:13:17:-3:-10:35:39:-8:48:::
649 671 0.000405289 66 0.000391938 TGTGCGAGGGACACGCATAGTGCGAGTTACGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-11*00(842.4) IGHD1-26*00(42) IGHJ4*00(210.9) nan 442|453|473|0|11|SA450G|81.0 23|37|60|16|30|SG29CSC33T|42.0 28|37|68|30|39|SA32T|61.0 nan TGTGCGAGGGACACGCATAGTGCGAGTTACGACTTCTGG 45 CARDTHSASYDFW :::::::::0:0:11:16:-3:-3:30:30:-8:39:::
650 671 0.000405289 58 0.00034443 TGTGCGAGAGATCGCTCCCGCGAGTGGGAGTACTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-31*00(380.1) IGHD1-2600(30),IGHD3-300(30) IGHJ4*00(468.6) IGHG3*00(121.1) 445|462|476|0|17|ST458G|141.0 25|31|60|22|28||30.0;46|52|93|21|27||30.0 17|37|68|28|48||200.0 nan TGTGCGAGAGATCGCTCCCGCGAGTGGGAGTACTACTTTGACTACTGG 45 CARDRSREWEYYFDYW :::::::::0:6:17:22:-5:-9:28:28:3:48:::
652 669 0.000404081 72 0.000427569 TGTATCACAGATCCCTTTTCCTATGATATTAGTGGAGGGGACTGCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-15*00(386.8) IGHD3-22*00(62) IGHJ4*00(325.9) IGHG100(117.6),IGHG200(117.6),IGHG400(117.6),IGHGP00(117.6) 448|461|479|0|13|SC452T|101.0 34|52|93|17|35|SA36CSG45T|62.0 28|37|68|39|48|SA32G|61.0 ;;; TGTATCACAGATCCCTTTTCCTATGATATTAGTGGAGGGGACTGCTGG 45 CITDPFSYDISGGDCW :::::::::0:2:13:17:-3:-10:35:39:-8:48:::
659 665 0.000401665 68 0.000403815 TGTGCGAAGATTATTGTCCCTAATCCTAGCTACTTCTTTAACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(498.7) IGHD5-1200(36),IGHD5-1800(36),IGHD2-15*00(35) IGHJ4*00(371.6) IGHM*00(117.4) 442|450|473|0|8||80.0 1|11|69|20|30|SG6C|36.0;1|11|69|20|30|SG6C|36.0;26|33|93|22|29||35.0 19|37|68|30|48|SA23TSG28A|122.0 nan TGTGCGAAGATTATTGTCCCTAATCCTAGCTACTTCTTTAACTACTGG 45 CAKIIVPNPSYFFNYW :::::::::0:-3:8:20:22:-35:30:30:1:48:::
663 660 0.000398645 76 0.000451322 TGTGCGAGCAGGGGGTGGATACAGCTATGGTTACCCTCCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(480.4) IGHD5-5*00(100) IGHJ4*00(367.4) IGHM*00(132.5) 442|449|473|0|7||70.0 20|40|60|14|34||100.0 30|37|68|38|45||70.0 nan TGTGCGAGCAGGGGGTGGATACAGCTATGGTTACCCTCCTACTGG 45 CASRGWIQLWLPSYW :::::::::0:-4:7:14:0:0:34:38:-10:45:::
693 633 0.000382337 65 0.000386 TGTGCGAGACGGGTCACGGTGTTAACACCTAACTACTACCTGTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(357.6) IGHD4-2300(42),IGHD2-200(40),IGHD3-22*00(36) IGHJ6*00(380.5) IGHA100(82.4),IGHA200(82.4) 445|455|476|0|10||100.0 24|38|57|15|29|SG30TST35A|42.0;15|23|93|31|39||40.0;7|17|93|29|39|SC11T|36.0 40|52|83|45|57||120.0 ; TGTGCGAGACGGGTCACGGTGTTAACACCTAACTACTACCTGTACATGGACGTCTGG 45 CARRVTVLTPNYYLYMDVW :::::::::0:-1:10:15:-5:0:29:45:-20:57:::
706 625 0.000377505 56 0.000332553 TGTGCGAAAGATCACGGCGGAGTGTCTGGTGATTTTGACTTGTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-2*00(567) IGHD6-1900(36),IGHD2-2100(35),IGHD2-8*00(33) IGHJ4*00(336.3) IGHA100(88.4),IGHA200(88.4) 442|455|473|0|13|SG449A|101.0 30|40|63|20|30|SG34T|36.0;40|47|84|26|33||35.0;38|48|93|22|31|DA41|33.0 25|37|68|33|45|SA32TSC33G|62.0 ; TGTGCGAAAGATCACGGCGGAGTGTCTGGTGATTTTGACTTGTGG 45 CAKDHGGVSGDFDLW :::::::::0:2:13:20:-9:-2:30:33:-5:45:::
711 621 0.000375089 65 0.000386 TGTGCGAAAGGGGGTGCTCTTAACTACTACTATTACATGGACGTCTGC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(502.8) nan IGHJ6*00(373.3) IGHM*00(117.9) 442|452|473|0|10||100.0 nan 23|52|83|22|48|SC33TDG37DG38DT39SG51C|118.0 nan TGTGCGAAAGGGGGTGCTCTTAACTACTACTATTACATGGACGTCTGC 45 CAKGGALNYYYYMDVC :::::::::0:-1:10:::::22:-3:48:::
719 613 0.000370257 67 0.000397876 TGTGTTAGAGATCTGGTCGGGGCGAAGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(809.4) nan IGHJ4*00(244.1) nan 442|456|473|0|14|SC446TSA447T|82.0 nan 28|37|68|27|36||90.0 nan TGTGTTAGAGATCTGGTCGGGGCGAAGGACTACTGG 45 CVRDLVGAKDYW :::::::::0:3:14:::::27:-8:36:::
730 606 0.000366028 65 0.000386 TGTGCGCGAAGAAGTTTTTGGAGTGGCTACCCTTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-46*00(657.4) IGHD3-3*00(61) IGHJ4*00(291.2) nan 442|451|473|0|9|SA448C|61.0 40|55|93|14|29|ST52C|61.0 25|37|68|33|45||120.0 nan TGTGCGCGAAGAAGTTTTTGGAGTGGCTACCCTTTTGACTACTGG 45 CARRSFWSGYPFDYW :::::::::0:-2:9:14:-9:-7:29:33:-5:45:::
739 601 0.000363008 61 0.000362246 TGTGCGAGAGAAGCTACGGTGACTACATGGAGGAACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-2*00(686.4) IGHD4-17*00(65) IGHJ4*00(293.6) nan 442|453|473|0|11||110.0 19|32|48|13|26||65.0 23|37|68|34|48||140.0 nan TGTGCGAGAGAAGCTACGGTGACTACATGGAGGAACTTTGACTACTGG 45 CAREATVTTWRNFDYW :::::::::0:0:11:13:-3:0:26:34:-3:48:::
755 588 0.000355156 64 0.000380061 TGTGTAACTTCGGGGTGGCTAGAGCGATCCTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(920.3) IGHD5-1200(35),IGHD5-1800(35),IGHD5-24*00(30) IGHJ4*00(225.2) nan 442|449|473|0|7|SC446T|41.0 32|39|69|14|21||35.0;32|39|69|14|21||35.0;27|33|60|15|21||30.0 30|37|68|29|36|SA32T|41.0 nan TGTGTAACTTCGGGGTGGCTAGAGCGATCCTTCTGG 45 CVTSGWLERSFW :::::::::0:-4:7:14:-9:-7:21:29:-10:36:::
756 588 0.000355156 57 0.000338492 TGTGCGAGAGGCAGAGATGACTACAGTCCGCCCGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(799.4) IGHD4-1100(55),IGHD4-400(55),IGHD5-24*00(51) IGHJ5*00(124.2) nan 442|452|473|0|10||100.0 15|26|48|16|27||55.0;15|26|48|16|27||55.0;22|35|60|12|25|SG29A|51.0 30|40|71|32|42|SC35A|71.0 nan TGTGCGAGAGGCAGAGATGACTACAGTCCGCCCGACCACTGG 45 CARGRDDYSPPDHW :::::::::0:-1:10:16:1:-6:27:32:-10:42:::
764 586 0.000353948 59 0.000350369 TGCGCAAGAGGGAATGATGGCTACGGGAGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(821.9) IGHD5-2400(45),IGHD5-1200(40),IGHD5-18*00(40) IGHJ5*00(266.2) nan 442|452|473|0|10|ST444C|71.0 25|34|60|15|24||45.0;33|41|69|17|25||40.0;33|41|69|17|25||40.0 26|40|71|28|42||140.0 nan TGCGCAAGAGGGAATGATGGCTACGGGAGGTTCGACCCCTGG 45 CARGNDGYGRFDPW :::::::::0:-1:10:15:-5:-6:24:28:-6:42:::
768 582 0.000351532 56 0.000332553 TGTGCGAAATCGCCGGCGGGTATGGATATGTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(814.1) IGHD5-1200(35),IGHD6-1300(35),IGHD6-25*00(35) IGHJ5*00(238.2) nan 442|451|473|0|9||90.0 24|31|69|22|29||35.0;20|27|63|16|23||35.0;17|24|54|16|23||35.0 25|40|71|30|45||150.0 nan TGTGCGAAATCGCCGGCGGGTATGGATATGTGGTTCGACCCCTGG 45 CAKSPAGMDMWFDPW :::::::::0:-2:9:22πŸ‘Ž-15:29:30:-5:45:::
774 578 0.000349116 55 0.000326615 TGTGCGAGAGATGAACCGGGCATGCAGCAATGGCCTGAGAACTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-2*00(671.1) IGHD6-1300(44),IGHD6-2500(39),IGHD2-2*00(38) IGHJ5*00(266) nan 442|454|473|0|12||120.0 19|34|63|15|29|ST24CDA27|44.0;16|30|54|15|28|ST21CDA24|39.0;0|11|93|18|28|DA5|38.0 22|40|71|39|57||180.0 nan TGTGCGAGAGATGAACCGGGCATGCAGCAATGGCCTGAGAACTGGTTCGACCCCTGG 45 CARDEPGMQQWPENWFDPW :::::::::0:1:12:15:2:-8:29:39:-2:57:::
786 569 0.00034368 56 0.000332553 TGTGCGAGAATTGAATGCGGTCGTGGCACTTGCTACGGGGTCGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-400(293.3),IGHV4-5500(293.3) IGHD4-2300(33),IGHD5-1200(30),IGHD6-25*00(30) IGHJ4*00(367.6) IGHM*00(109.9) 442|451|473|0|9||90.0;442|451|473|0|9||90.0 22|32|57|32|41|DT28|33.0;35|41|69|31|37||30.0;31|37|54|31|37||30.0 28|37|68|42|51||90.0 nan TGTGCGAGAATTGAATGCGGTCGTGGCACTTGCTACGGGGTCGACTACTGG 45 CARIECGRGTCYGVDYW :::::::::0:-2:9:32:-3:-6:41:42:-8:51:::
794 562 0.000339452 60 0.000356307 TGTGCGAGATTCAACACGTATGACCATGATACTAATGGTTATAAGTTCTTTTATTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-5900(397.2),IGHV4-6100(388.9) IGHD3-22*00(80) IGHJ4*00(442.4) nan 439|448|470|0|9||90.0;445|454|476|0|9||90.0 26|56|93|12|42|ST28CST35GST38CSG45CSG48A|80.0 19|37|68|51|69|SC21T|151.0 nan TGTGCGAGATTCAACACGTATGACCATGATACTAATGGTTATAAGTTCTTTTATTACTTTGACTACTGG 45 CARFNTYDHDTNGYKFFYYFDYW :::::::::0:-2:9:12:5:-6:42:51:1:69:::
798 560 0.000338244 57 0.000338492 TGTGCCAGAAGTACGCATCAGTGGCGCAACTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-30-2*00(440.6) IGHD6-1900(35),IGHD5-1200(30),IGHD5-18*00(30) IGHJ5*00(391.7) IGHD*00(133.8) 445|454|476|0|9||90.0 29|36|63|18|25||35.0;31|37|69|19|25||30.0;31|37|69|19|25||30.0 21|40|71|26|45||190.0 nan TGTGCCAGAAGTACGCATCAGTGGCGCAACTGGTTCGACCCCTGG 45 CARSTHQWRNWFDPW :::::::::0:-2:9:18:-8:-6:25:26πŸ‘Ž45:::
799 559 0.00033764 63 0.000374123 TGTGCAAGTGGGCCCTGGTTCGGCTGGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(928.5) IGHD1-1400(30),IGHD3-1000(30),IGHD6-19*00(30) IGHJ4*00(246.3) nan 442|450|473|0|8||80.0 1|7|51|15|21||30.0;40|46|93|15|21||30.0;33|39|63|21|27||30.0 28|37|68|27|36||90.0 nan TGTGCAAGTGGGCCCTGGTTCGGCTGGGACTACTGG 45 CASGPWFGWDYW :::::::::0:-3:8:15:16:-27:21:27:-8:36:::
814 549 0.0003316 56 0.000332553 TGTGCGATGACCCCAAGGAGTGGGGCTTATGATGCTTATAGTACTTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(417.6) IGHD3-300(35),IGHD1-2600(33),IGHD3-16*00(30) IGHJ3*00(361.1) IGHA100(125.2),IGHA200(125.2) 442|449|473|0|7||70.0 45|52|93|16|23||35.0;25|35|60|18|27|DA31|33.0;16|22|111|10|16||30.0 19|39|70|28|48|ST28ASG30ASA31GST34CSC35T|55.0 ; TGTGCGATGACCCCAAGGAGTGGGGCTTATGATGCTTATAGTACTTGG 45 CAMTPRSGAYDAYSTW :::::::::0:-4:7:16:-14:-10:23:28:1:48:::
816 547 0.000330392 53 0.000314738 TGTGCGAGTGAGAATGGTGGCCACGCTAACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(376.3) IGHD6-1900(33),IGHD5-1200(32),IGHD5-18*00(32) IGHJ4*00(390.8) IGHA100(151.4),IGHA200(151.4) 445|453|476|0|8||80.0 6|16|63|19|28|DT11|33.0;2|14|69|12|24|SC5GSA8G|32.0;2|14|69|12|24|SC5GSA8G|32.0 23|37|68|28|42||140.0 ; TGTGCGAGTGAGAATGGTGGCCACGCTAACTTTGACTACTGG 45 CASENGGHANFDYW :::::::::0:-3:8:19:15:-26:28:28:-3:42:::
820 544 0.00032858 55 0.000326615 TGTGCGAGAGATTCTGCGTTGAAAGCTATAGGGGACTCCTTTGATTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(928.8),IGHV3-700(920.3) IGHD5-500(30),IGHD6-1300(30),IGHD6-25*00(30) IGHJ4*00(159.8) nan 442|454|473|0|12||120.0;442|454|473|0|12||120.0 28|34|60|23|29||30.0;12|18|63|24|30||30.0;9|15|54|24|30||30.0 20|37|68|34|51|SA23CSC30T|112.0 nan TGTGCGAGAGATTCTGCGTTGAAAGCTATAGGGGACTCCTTTGATTACTGG 45 CARDSALKAIGDSFDYW :::::::::0:1:12:23:-8:-6:29:34:0:51:::
836 537 0.000324352 57 0.000338492 TGTGCGAGAGGGTTCAGTTACTACAACGGTTTGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-35*00(181.5) IGHD3-10*00(35) IGHJ6*00(395.4) IGHM*00(145.6) 442|451|473|0|9|ST446C|61.0 41|48|93|10|17||35.0 28|52|83|18|42|ST34ASA40T|182.0 nan TGTGCGAGAGGGTTCAGTTACTACAACGGTTTGGACGTCTGG 45 CARGFSYYNGLDVW :::::::::0:-2:9:10:-10:-14:17:18:-8:42:::
844 534 0.00032254 49 0.000290984 TGTGCGAGACATCCTCTGGGATATAGCACCTCGCCCGTCTATTACCACGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(460.7) IGHD6-6*00(52) IGHJ6*00(493.7) IGHM*00(53.1) 445|457|476|0|12||120.0 21|37|54|21|37|SG28CST33C|52.0 27|52|83|38|63|SC30TST34C|192.0 nan TGTGCGAGACATCCTCTGGGATATAGCACCTCGCCCGTCTATTACCACGGTATGGACGTCTGG 45 CARHPLGYSTSPVYYHGMDVW :::::::::0:1:12:21:-3:1:37:38:-7:63:::
851 532 0.000321332 58 0.00034443 TGTGTGAAAGGGGGGGGATTTTTTGGCATTTCTATCGACGCTGACTACTACTACTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(376.9) IGHD3-300(35),IGHD3-1600(31),IGHD3-9*00(31) IGHJ6*00(445.6) nan 442|452|473|0|10|SC446T|71.0 38|45|93|16|23||35.0;54|63|111|12|21|SG60T|31.0;38|47|93|16|25|SA41T|31.0 23|52|83|43|69|DG37DG38DT39|176.0 nan TGTGTGAAAGGGGGGGGATTTTTTGGCATTTCTATCGACGCTGACTACTACTACTACATGGACGTCTGG 45 CVKGGGFFGISIDADYYYYMDVW :::::::::0:-1:10:16:-7:-17:23:43:-3:69:::
856 530 0.000320124 53 0.000314738 TGTGCGAGAGATAATTCCTACGGTGACTACACTTGGTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-46*00(661) IGHD4-17*00(65) IGHJ5*00(276.7) nan 442|454|473|0|12||120.0 19|32|48|17|30||65.0 25|40|71|36|51||150.0 nan TGTGCGAGAGATAATTCCTACGGTGACTACACTTGGTGGTTCGACCCCTGG 45 CARDNSYGDYTWWFDPW :::::::::0:1:12:17:-3:0:30:36:-5:51:::
874 522 0.000315292 56 0.000332553 TGTGCGAGAGGCAGAGATGGCTACGATCCGCCCGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(934.2) IGHD5-24*00(61) IGHJ4*00(185.6) nan 442|452|473|0|10||100.0 22|37|60|12|27|SA34G|61.0 28|37|68|33|42||90.0 nan TGTGCGAGAGGCAGAGATGGCTACGATCCGCCCGACTACTGG 45 CARGRDGYDPPDYW :::::::::0:-1:10:12:-2:-3:27:33:-8:42:::
901 508 0.000306836 47 0.000279107 TGTGCGCGAAGACTTTTTTGGAGTGGTTACCCTTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-46*00(611.7) IGHD3-3*00(75) IGHJ4*00(282.9) nan 442|451|473|0|9|SA448C|61.0 40|55|93|14|29||75.0 25|37|68|33|45||120.0 nan TGTGCGCGAAGACTTTTTTGGAGTGGTTACCCTTTTGACTACTGG 45 CARRLFWSGYPFDYW :::::::::0:-2:9:14:-9:-7:29:33:-5:45:::
912 504 0.00030442 48 0.000285046 TGTGCGAGTCTCGGTGGTAACTCTGTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(808.1),IGHV3-700(808.1) IGHD4-23*00(60) IGHJ4*00(292.1) nan 442|450|473|0|8||80.0;442|450|473|0|8||80.0 25|37|57|11|23||60.0 26|37|68|25|36||110.0 nan TGTGCGAGTCTCGGTGGTAACTCTGTTGACTACTGG 45 CASLGGNSVDYW :::::::::0:-3:8:11:-6:-1:23:25:-6:36:::
925 497 0.000300192 60 0.000356307 TGTGTAAGAGATCTGGTCGGGTCGAGGGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(914.4) IGHD6-600(27),IGHD6-1300(25),IGHD6-25*00(25) IGHJ4*00(214.5) nan 442|456|473|0|14|SC446T|111.0 32|43|54|15|26|SC35GSA38T|27.0;20|25|63|17|22||25.0;17|22|54|17|22||25.0 28|37|68|27|36|ST31C|61.0 nan TGTGTAAGAGATCTGGTCGGGTCGAGGGACCACTGG 45 CVRDLVGSRDHW :::::::::0:3:14:15:-14:7:26:27:-8:36:::
932 495 0.000298984 49 0.000290984 TGTGCGAGAGATCATATAAAGGGCTGGAGCCTTGAGTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(861.2),IGHV3-700(861.2) IGHD6-19*00(30) IGHJ4*00(205.9) nan 442|455|473|0|13||130.0;442|455|473|0|13||130.0 33|39|63|21|27||30.0 26|37|68|31|42|SC30G|81.0 nan TGTGCGAGAGATCATATAAAGGGCTGGAGCCTTGAGTACTGG 45 CARDHIKGWSLEYW :::::::::0:2:13:21:-12:-3:27:31:-6:42:::
949 490 0.000295964 47 0.000279107 TGTGCGAGACACCCCGGGGCTGAGTTATATCTGTGGTTCGCAGACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(465.1) IGHD2-2100(38),IGHD1-700(35),IGHD3-10*00(35) IGHJ4*00(342.7) IGHM*00(125.3) 445|456|476|0|11||110.0 31|41|84|26|37|I35C|38.0;8|15|51|22|29||35.0;49|56|93|21|28||35.0 32|37|68|43|48||50.0 nan TGTGCGAGACACCCCGGGGCTGAGTTATATCTGTGGTTCGCAGACTGG 45 CARHPGAELYLWFADW :::::::::0:0:11:26:-3:-15:37:43:-12:48:::
959 487 0.000294152 60 0.000356307 TGTGCGAGAGAGGTGGGTTCAGCTGGTAAAGGAGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-59*00(855) IGHD2-200(45),IGHD6-1300(45) IGHJ4*00(199) nan 439|450|470|0|11||110.0 7|16|93|19|28||45.0;32|41|63|19|28||45.0 28|37|68|33|42|SA32T|61.0 nan TGTGCGAGAGAGGTGGGTTCAGCTGGTAAAGGAGACTTCTGG 45 CAREVGSAGKGDFW :::::::::0:0:11:19:24:-46:28:33:-8:42:::
966 485 0.000292944 54 0.000320677 TGTGTGAAAGGCCTCCTCCCGCCAGATACGCTGGGTGATGCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(647.5) IGHD2-2100(30),IGHD3-1600(29),IGHD5-5*00(28) IGHJ5*00(149.8) nan 442|452|473|0|10|SC446T|71.0 41|47|84|33|39||30.0;13|24|111|15|27|I18GSA21G|29.0;23|32|60|24|32|DA28|28.0 35|40|71|40|45||50.0 nan TGTGTGAAAGGCCTCCTCCCGCCAGATACGCTGGGTGATGCCTGG 45 CVKGLLPPDTLGDAW :::::::::0:-1:10:33:-13:-9:39:40:-15:45:::
1005 473 0.000285695 66 0.000391938 TGCGCGAGGAGTCCCCGGTGGGAGCTTCGTTATTATTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-4*00(297.7) IGHD1-2600(45),IGHD3-1600(44),IGHD3-10*00(41) IGHJ6*00(225.3) IGHA100(111.4),IGHA200(111.4) 442|450|473|0|8|ST444C|51.0 26|35|60|17|26||45.0;56|71|111|19|33|ST61CDA63|44.0;51|62|93|28|39|SA59T|41.0 40|52|83|39|51||120.0 ; TGCGCGAGGAGTCCCCGGTGGGAGCTTCGTTATTATTACATGGACGTCTGG 45 CARSPRWELRYYYMDVW :::::::::0:-3:8:17:-6:-5:26:39:-20:51:::
1013 470 0.000283883 45 0.00026723 TGTGCGCGAGATCTGTATAGCAGTGGCTTCGTCTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-3*00(545.3) IGHD6-1900(70),IGHD6-2500(62) IGHJ5*00(435) IGHM*00(74.5) 442|456|473|0|14|SA448C|111.0 23|37|63|14|28||70.0;20|38|54|14|32|SC29TSA34T|62.0 24|40|71|32|48||160.0 nan TGTGCGCGAGATCTGTATAGCAGTGGCTTCGTCTGGTTCGACCCCTGG 45 CARDLYSSGFVWFDPW :::::::::0:3:14:14:-2:-5:28:32:-4:48:::
1025 466 0.000281467 47 0.000279107 TGTGCGAAAGGGATCAGTTACTTCTACGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(561.1) IGHD7-27*00(25) IGHJ6*00(493.8) IGHM*00(146.5) 442|452|473|0|10||100.0 19|24|33|10|15||25.0 28|52|83|18|42|SA32T|211.0 nan TGTGCGAAAGGGATCAGTTACTTCTACGGTATGGACGTCTGG 45 CAKGISYFYGMDVW :::::::::0:-1:10:10:-8:2:15:18:-8:42:::
1031 465 0.000280863 47 0.000279107 TGTGCAAAAGATTTTGGTGGTGAGACTGACCAGTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(267.3) IGHD2-2100(45),IGHD2-800(40) IGHJ4*00(311.4) IGHA100(177.5),IGHA200(177.5) 442|454|473|0|12|SG449A|91.0 37|46|84|14|23||45.0;43|51|93|14|22||40.0 27|37|68|26|36|ST31CSC33G|42.0 ; TGTGCAAAAGATTTTGGTGGTGAGACTGACCAGTGG 45 CAKDFGGETDQW :::::::::0:1:12:14:-9:-10:23:26:-7:36:::
1037 459 0.000277239 48 0.000285046 TGTGCCTTAGTGGTGGTAGCTGCTAAGTCACGATGGTACTTCGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-26*00(962) IGHD2-15*00(90) IGHJ2*00(217.1) nan 445|450|478|0|5||50.0 40|58|93|7|25||90.0 24|42|73|33|51||180.0 nan TGTGCCTTAGTGGTGGTAGCTGCTAAGTCACGATGGTACTTCGATCTCTGG 45 CALVVVAAKSRWYFDLW :::::::::0:-8:5:7:-9:-4:25:33:-4:51:::
1039 459 0.000277239 50 0.000296923 TGTGCGAGACGGGTCACGGTATTAACACCTCACTACTACCTGTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(343.2) IGHD3-2200(41),IGHD1-2600(40),IGHD2-2*00(40) IGHJ6*00(381.1) IGHA100(82.8),IGHA200(82.8) 445|455|476|0|10||100.0 0|19|93|18|38|SG3TST7CSA9CI11T|41.0;0|24|60|18|44|SG3TSG6AST8AI11TI16CSG20T|40.0;15|23|93|31|39||40.0 40|52|83|45|57||120.0 ; TGTGCGAGACGGGTCACGGTATTAACACCTCACTACTACCTGTACATGGACGTCTGG 45 CARRVTVLTPHYYLYMDVW :::::::::0:-1:10:18:31:-43:38:45:-20:57:::
1040 459 0.000277239 42 0.000249415 TGTGCAAGGTTTATAATTGGAACTTCTGGTGCTTTTGATATGTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(871.4) IGHD1-700(51),IGHD1-2000(46) IGHJ3*00(225) nan 442|450|473|0|8||80.0 19|32|51|11|24|SC24T|51.0;19|31|51|11|23|SC24T|46.0 20|39|70|26|45|SA22GSC35G|132.0 nan TGTGCAAGGTTTATAATTGGAACTTCTGGTGCTTTTGATATGTGG 45 CARFIIGTSGAFDMW :::::::::0:-3:8:11:-2:-2:24:26:0:45:::
1041 459 0.000277239 46 0.000273169 TGTACACGGGCTGGTTCTTACCGACATGACTATTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(848.5) IGHD6-1900(42),IGHD6-1300(37),IGHD3-22*00(36) IGHJ4*00(256.8) nan 442|448|473|0|6|SG445A|31.0 33|47|63|8|22|SA40TSG42T|42.0;34|47|63|9|22|SA40TSG42T|37.0;49|59|93|11|21|SA54C|36.0 27|37|68|26|36|SC33T|71.0 nan TGTACACGGGCTGGTTCTTACCGACATGACTATTGG 45 CTRAGSYRHDYW :::::::::0:-5:6:8:-12:5:22:26:-7:36:::
1050 456 0.000275427 48 0.000285046 TGTGCGAGTGGAAGTGGGTGGCTGGCCCCCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-33*00(853.9) IGHD6-19*00(40) IGHJ4*00(224.2) nan 442|450|473|0|8||80.0 31|39|63|17|25||40.0 30|37|68|29|36||70.0 nan TGTGCGAGTGGAAGTGGGTGGCTGGCCCCCTACTGG 45 CASGSGWLAPYW :::::::::0:-3:8:17:-10:-3:25:29:-10:36:::
1056 453 0.000273615 44 0.000261292 TGTGCGAAAGGGATCAGTTACTTCTACGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(972.7) IGHD7-27*00(25) IGHJ6*00(325) nan 442|452|473|0|10||100.0 19|24|33|10|15||25.0 28|52|83|18|42|SA32T|211.0 nan TGTGCGAAAGGGATCAGTTACTTCTACGGTATGGACGTCTGG 45 CAKGISYFYGMDVW :::::::::0:-1:10:10:-8:2:15:18:-8:42:::
1059 452 0.000273011 48 0.000285046 TGTGCGAGATGGATATACAGTTCTGGTTCCTGGGGGCTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(832.8) IGHD5-500(42),IGHD5-1200(40) IGHJ4*00(175.4) nan 442|451|473|0|9||90.0 24|38|60|14|28|SC30TSA32C|42.0;24|32|69|9|17||40.0 26|37|68|37|48||110.0 nan TGTGCGAGATGGATATACAGTTCTGGTTCCTGGGGGCTTGACTACTGG 45 CARWIYSSGSWGLDYW :::::::::0:-2:9:14:-4:-2:28:37:-6:48:::
1060 452 0.000273011 45 0.00026723 TGTGGAAGAGATACGGGCGGTTCGGGGAGCCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(309.3) IGHD3-10*00(41) IGHJ500(329.5),IGHJ400(322.3) IGHA100(177.8),IGHA200(177.8) 442|454|473|0|12|SC446G|91.0 41|52|93|18|29|SA46G|41.0 33|40|71|29|36|SC35T|41.0;33|37|68|32|36||40.0 ; TGTGGAAGAGATACGGGCGGTTCGGGGAGCCTCTGG 45 CGRDTGGSGSLW :::::::::0:1:12:18:-10:-10:29:29:-13:36:::
1077 446 0.000269387 44 0.000261292 TGTGCGAGACATCCCACTGGCTTCCCCAACTGGTTCGACCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(658.8) IGHD1-1400(31),IGHD1-2600(30),IGHD6-19*00(30) IGHJ5*00(277.1) nan 445|457|476|0|12||120.0 30|42|51|13|25|DG34I38C|31.0;9|15|60|12|18||30.0;7|13|63|13|19||30.0 21|40|71|26|45|SC35T|161.0 nan TGTGCGAGACATCCCACTGGCTTCCCCAACTGGTTCGACCTCTGG 45 CARHPTGFPNWFDLW :::::::::0:1:12:13:-13:8:25:26πŸ‘Ž45:::
1088 443 0.000267575 45 0.00026723 TGTGCGAGAATCGAGGGCAGCAGCTGGCAATACTCCTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-5900(429.1),IGHV4-6100(429.1) IGHD6-13*00(55) IGHJ4*00(430.4) IGHM*00(114.5) 439|448|470|0|9||90.0;445|454|476|0|9||90.0 28|39|63|16|27||55.0 19|37|68|30|48|SA23C|151.0 nan TGTGCGAGAATCGAGGGCAGCAGCTGGCAATACTCCTTTGACTACTGG 45 CARIEGSSWQYSFDYW :::::::::0:-2:9:16:-7:-3:27:30:1:48:::
1095 440 0.000265763 47 0.000279107 TGTGCGAGAGATTCCCCCCGTATTAATATGACAAAGAGTGATGCATTTGATGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-69D*00(392.1) IGHD3-2200(51),IGHD3-1000(46) IGHJ3*00(370) nan 442|454|473|0|12||120.0 30|43|93|18|31|SC37A|51.0;30|42|93|18|30|SC37A|46.0 20|39|70|38|57|ST26ASA33G|132.0 nan TGTGCGAGAGATTCCCCCCGTATTAATATGACAAAGAGTGATGCATTTGATGTCTGG 45 CARDSPRINMTKSDAFDVW :::::::::0:1:12:18:1:-19:31:38:0:57:::
1098 439 0.000265159 47 0.000279107 TGTGCGAGCAGGGGGTGGATACAGCTATGGTTACCCTCCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(1002.8) IGHD5-5*00(100) IGHJ4*00(156.5) nan 442|449|473|0|7||70.0 20|40|60|14|34||100.0 30|37|68|38|45||70.0 nan TGTGCGAGCAGGGGGTGGATACAGCTATGGTTACCCTCCTACTGG 45 CASRGWIQLWLPSYW :::::::::0:-4:7:14:0:0:34:38:-10:45:::
1099 439 0.000265159 45 0.00026723 TGTGCGAGACATGGGCACAACCACTGGTACGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(427.3) IGHD1-1400(38),IGHD3-300(35),IGHD6-13*00(35) IGHJ4*00(359) IGHM*00(167.7) 445|458|476|0|13||130.0 28|39|51|18|28|DG34|38.0;8|15|93|18|25||35.0;35|42|63|23|30||35.0 28|37|68|30|39||90.0 nan TGTGCGAGACATGGGCACAACCACTGGTACGACTACTGG 45 CARHGHNHWYDYW :::::::::0:2:13:18:-11:5:28:30:-8:39:::
1108 436 0.000263347 42 0.000249415 TGTGCGAGACTACAGGTGACCGAACCCCAGCCCGACCGCTATTACTACCTCGGAATGGACCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(494) IGHD4-1700(33),IGHD7-2700(31),IGHD6-19*00(30) IGHJ6*00(379.9) IGHA100(40),IGHA200(40) 442|452|473|0|10||100.0 20|29|48|10|20|I23A|33.0;20|29|33|21|30|ST22A|31.0;3|9|63|26|32||30.0 24|52|83|38|66|SC27TST34CSA35TST39ASG46C|135.0 ; TGTGCGAGACTACAGGTGACCGAACCCCAGCCCGACCGCTATTACTACCTCGGAATGGACCTCTGG 45 CARLQVTEPQPDRYYYLGMDLW :::::::::0:-1:10:10:-4:-3:20:38:-4:66:::
1109 436 0.000263347 48 0.000285046 TGTACTAGACCTATAGGAGCGGGAAATTGGCTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-73*00(935.2) IGHD6-25*00(41) IGHJ5*00(271.1) nan 448|458|479|0|10||100.0 21|32|54|11|22|SC26G|41.0 22|40|71|24|42|SC24TST28C|122.0 nan TGTACTAGACCTATAGGAGCGGGAAATTGGCTCGACCCCTGG 45 CTRPIGAGNWLDPW :::::::::0:-1:10:11:-3:-4:22:24:-2:42:::
1116 433 0.000261535 46 0.000273169 TGTGCGAGAGACCCCTATGTCCGGTCTGGCCCCTGGTACTTCGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-48*00(474) IGHD2-200(33),IGHD2-2100(33),IGHD1-14*00(30) IGHJ2*00(451.3) IGHA100(103.8),IGHA200(103.8) 442|453|473|0|11||110.0 55|64|93|14|24|I60T|33.0;49|58|84|14|24|I53G|33.0;5|11|51|19|25||30.0 23|42|73|32|51||190.0 ; TGTGCGAGAGACCCCTATGTCCGGTCTGGCCCCTGGTACTTCGATCTCTGG 45 CARDPYVRSGPWYFDLW :::::::::0:0:11:14:-24:2:24:32:-3:51:::
1124 431 0.000260327 43 0.000255354 TGTGCGAGACATGGGCACAACCACTGGTACGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(840) IGHD1-1400(38),IGHD3-300(35),IGHD6-13*00(35) IGHJ4*00(257.9) nan 445|458|476|0|13||130.0 28|39|51|18|28|DG34|38.0;8|15|93|18|25||35.0;35|42|63|23|30||35.0 28|37|68|30|39||90.0 nan TGTGCGAGACATGGGCACAACCACTGGTACGACTACTGG 45 CARHGHNHWYDYW :::::::::0:2:13:18:-11:5:28:30:-8:39:::
1129 429 0.000259119 40 0.000237538 TGTGCGAGAGAAGCTACGGTGACTACATGGAGGAACTTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-2*00(678.4) IGHD4-17*00(65) IGHJ4*00(259.5) nan 442|453|473|0|11||110.0 19|32|48|13|26||65.0 23|37|68|34|48|SA32C|111.0 nan TGTGCGAGAGAAGCTACGGTGACTACATGGAGGAACTTTGACTCCTGG 45 CAREATVTTWRNFDSW :::::::::0:0:11:13:-3:0:26:34:-3:48:::
1141 427 0.000257911 47 0.000279107 TGTGCGAGAGGGGACTTTGAAATAGTTCCAATGAGTACGACTTATCACTATTACTACTACTTGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-4*00(354.6) IGHD1-7*00(40) IGHJ6*00(346.8) nan 442|452|473|0|10||100.0 1|9|51|22|30||40.0 19|52|83|42|72|ST22CSC27TDG37DG38DT39SA40T|129.0 nan TGTGCGAGAGGGGACTTTGAAATAGTTCCAATGAGTACGACTTATCACTATTACTACTACTTGGACGTCTGG 45 CARGDFEIVPMSTTYHYYYYLDVW :::::::::0:-1:10:22:16:-25:30:42:1:72:::
1156 422 0.000254891 37 0.000219723 TGTGCGAGATCCTTGACTACGGAGACTACCCGCCACTTTGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(501.7) IGHD4-17*00(66) IGHJ4*00(373.8) IGHG100(119.3),IGHG200(119.3),IGHG400(119.3),IGHGP00(119.3) 442|451|473|0|9||90.0 16|32|48|13|29|ST25A|66.0 23|37|68|34|48|SA32T|111.0 ;;; TGTGCGAGATCCTTGACTACGGAGACTACCCGCCACTTTGACTTCTGG 45 CARSLTTETTRHFDFW :::::::::0:-2:9:13:0:0:29:34:-3:48:::
1157 422 0.000254891 42 0.000249415 TGTGCGAGACGCCCTCTCGAGTATAGCAGCCCCTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(956.6) IGHD6-6*00(75) IGHJ4*00(264.8) nan 442|452|473|0|10||100.0 15|30|54|15|30||75.0 21|37|68|32|48||160.0 nan TGTGCGAGACGCCCTCTCGAGTATAGCAGCCCCTACTTTGACTACTGG 45 CARRPLEYSSPYFDYW :::::::::0:-1:10:15:3:-6:30:32πŸ‘Ž48:::
1165 420 0.000253683 42 0.000249415 TGTGTAAGAGATTTGGTCGGGGCGAAGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(941.1) nan IGHJ4*00(264.8) nan 442|454|473|0|12|SC446T|91.0 nan 28|37|68|27|36||90.0 nan TGTGTAAGAGATTTGGTCGGGGCGAAGGACTACTGG 45 CVRDLVGAKDYW :::::::::0:1:12:::::27:-8:36:::
1172 419 0.000253079 50 0.000296923 TGTGTGAAAGGGGGGGGGTTTTTTGGCATTTCTATCGGCGCTGACTACTACTACTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(440.8) IGHD3-300(35),IGHD3-1600(31) IGHJ6*00(441.5) nan 442|452|473|0|10|SC446T|71.0 40|47|93|19|26||35.0;54|63|111|11|20|SA59G|31.0 23|52|83|43|69|DG37DG38DT39|176.0 nan TGTGTGAAAGGGGGGGGGTTTTTTGGCATTTCTATCGGCGCTGACTACTACTACTACATGGACGTCTGG 45 CVKGGGFFGISIGADYYYYMDVW :::::::::0:-1:10:19:-9:-15:26:43:-3:69:::
1177 418 0.000252475 37 0.000219723 TGTGCGAGAGACCACAGTCAGGACTATGATTCGGGGACTTATTGGTGGCTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-46*00(433.5) IGHD3-10*00(63) IGHJ5*00(284.7) nan 442|453|473|0|11||110.0 36|57|93|22|43|SG42ASA46GSG51C|63.0 25|40|71|45|60|ST28C|121.0 nan TGTGCGAGAGACCACAGTCAGGACTATGATTCGGGGACTTATTGGTGGCTCGACCCCTGG 45 CARDHSQDYDSGTYWWLDPW :::::::::0:0:11:22:-5:-5:43:45:-5:60:::
1180 417 0.000251871 42 0.000249415 TGCCTAAAGTATTACTATGATTCGGGGAGTTACTGGTACTTCGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-15*00(871.3) IGHD3-1000(67),IGHD3-2200(65) IGHJ2*00(269.5) nan 448|450|479|0|2||20.0 31|50|93|8|27|SG42ASA46G|67.0;31|44|93|8|21||65.0 18|42|73|27|51|SC20T|211.0 nan TGCCTAAAGTATTACTATGATTCGGGGAGTTACTGGTACTTCGATCTCTGG 45 CLKYYYDSGSYWYFDLW :::::::::0:-9:2:8:0:-12:27:27:2:51:::
1219 407 0.000245831 44 0.000261292 TGTGCGAGAGGCAGAGATGGCTACGATCCGCCCGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(426.1) IGHD5-24*00(61) IGHJ4*00(360.9) IGHA100(147.7),IGHA200(147.7) 442|452|473|0|10||100.0 22|37|60|12|27|SA34G|61.0 28|37|68|33|42||90.0 ; TGTGCGAGAGGCAGAGATGGCTACGATCCGCCCGACTACTGG 45 CARGRDGYDPPDYW :::::::::0:-1:10:12:-2:-3:27:33:-8:42:::
1239 400 0.000241603 38 0.000225661 TGTGCGAGAGACTCAGAAGGCTATGCATTGTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(844),IGHV3-700(844) IGHD2-200(35),IGHD5-2400(31),IGHD5-5*00(30) IGHJ400(218.9),IGHJ500(218.9) nan 442|453|473|0|11||110.0;442|453|473|0|11||110.0 54|61|93|19|26||35.0;24|33|60|14|23|ST27A|31.0;29|35|60|19|25||30.0 34|37|68|30|33||30.0;37|40|71|30|33||30.0 nan TGTGCGAGAGACTCAGAAGGCTATGCATTGTGG 45 CARDSEGYALW :::::::::0:0:11:19:-23:-1:26:30:-14:33:::
1246 398 0.000240395 38 0.000225661 TGTGCGGGAGATCGCTTTGGCAGTGGCTTCAGCTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-11*00(758.1) IGHD6-19*00(45) IGHJ4*00(186.1) nan 442|458|473|0|16|SA448GST455G|102.0 28|37|63|19|28||45.0 30|37|68|32|39|SA32T|41.0 nan TGTGCGGGAGATCGCTTTGGCAGTGGCTTCAGCTTCTGG 45 CAGDRFGSGFSFW :::::::::0:5:16:19:-7:-5:28:32:-10:39:::
1249 397 0.000239791 43 0.000255354 TGTGCGAGATTATCTAGCGGCAGCTGGCCCTACTACTTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(951.4),IGHV3-700(951.4) IGHD6-13*00(51) IGHJ4*00(217.8) nan 442|451|473|0|9||90.0;442|451|473|0|9||90.0 26|39|63|14|27|SA30G|51.0 19|37|68|30|48|SA32C|151.0 nan TGTGCGAGATTATCTAGCGGCAGCTGGCCCTACTACTTTGACTCCTGG 45 CARLSSGSWPYYFDSW :::::::::0:-2:9:14:-5:-3:27:30:1:48:::
1255 395 0.000238583 43 0.000255354 TGTATCACAGATCCCTATTCCTATGAGATTAGTGGAGGGGACTGCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-15*00(476.9) IGHD3-22*00(58) IGHJ4*00(335.1) IGHG100(118.6),IGHG200(118.6),IGHG400(118.6),IGHGP00(118.6) 448|461|479|0|13|SC452T|101.0 32|52|93|15|35|SA36CST43GSG45T|58.0 28|37|68|39|48|SA32G|61.0 ;;; TGTATCACAGATCCCTATTCCTATGAGATTAGTGGAGGGGACTGCTGG 45 CITDPYSYEISGGDCW :::::::::0:2:13:15πŸ‘Ž-10:35:39:-8:48:::
1275 392 0.000236771 41 0.000243477 TGTGCGCGAGCCCCCCAGAGGTGGGAGATGCTTATTATCTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-69D*00(752.4) IGHD3-300(44),IGHD3-2200(39),IGHD2-15*00(38) IGHJ6*00(186.3) nan 442|452|473|0|10|SA448C|71.0 45|59|93|23|38|I49ASG51C|44.0;49|62|93|28|42|SG51CI58T|39.0;41|57|93|16|32|ST43AST49GSC52A|38.0 40|52|83|42|54||120.0 nan TGTGCGCGAGCCCCCCAGAGGTGGGAGATGCTTATTATCTACATGGACGTCTGG 45 CARAPQRWEMLIIYMDVW :::::::::0:-1:10:23:-14:-3:38:42:-20:54:::
1276 392 0.000236771 39 0.0002316 TGTGCGAGGGGAGCCTACTACTACTACTCCATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-31*00(386.4) IGHD1-26*00(30) IGHJ6*00(410.4) IGHG100(158.3),IGHG200(158.3),IGHG400(158.3),IGHGP00(154.6) 445|453|476|0|8||80.0 28|34|60|8|14||30.0 24|52|83|14|42|SG37TSG38CST39C|193.0 ;;; TGTGCGAGGGGAGCCTACTACTACTACTCCATGGACGTCTGG 45 CARGAYYYYSMDVW :::::::::0:-3:8:8:-8:-6:14:14:-4:42:::
1293 388 0.000234355 37 0.000219723 TGTGCGAGAGGCAGAGATGGCTACAATCCGCCCGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(845.9) IGHD5-24*00(75) IGHJ5*00(118.9) nan 442|452|473|0|10||100.0 22|37|60|12|27||75.0 30|40|71|32|42|SC35A|71.0 nan TGTGCGAGAGGCAGAGATGGCTACAATCCGCCCGACCACTGG 45 CARGRDGYNPPDHW :::::::::0:-1:10:12:-2:-3:27:32:-10:42:::
1297 387 0.000233751 43 0.000255354 TGTGCACGGGCCGGTTCGTATAGTGGCAGTTACTACCTTGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-70*00(782.9) IGHD1-2600(46),IGHD5-1200(45),IGHD5-18*00(45) IGHJ4*00(189.6) nan 445|454|478|0|9||90.0 21|33|60|17|29|SG30C|46.0;28|37|69|18|27||45.0;28|37|69|18|27||45.0 19|37|68|30|48|ST25CST31C|122.0 nan TGTGCACGGGCCGGTTCGTATAGTGGCAGTTACTACCTTGACCACTGG 45 CARAGSYSGSYYLDHW :::::::::0:-4:9:17πŸ‘Ž-7:29:30:1:48:::
1316 384 0.000231939 37 0.000219723 TGTACTAGACCTATAGGAGCGGGAAATTGGCTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-73*00(520.8) IGHD6-25*00(41) IGHJ5*00(398.4) IGHM*00(137.9) 448|458|479|0|10||100.0 21|32|54|11|22|SC26G|41.0 22|40|71|24|42|SC24TST28C|122.0 nan TGTACTAGACCTATAGGAGCGGGAAATTGGCTCGACCCCTGG 45 CTRPIGAGNWLDPW :::::::::0:-1:10:11:-3:-4:22:24:-2:42:::
1327 382 0.000230731 37 0.000219723 TGTGCGAAACCGGCAATCCTCCAAAGTTGGTGGTCACTGCTAGGGGGGGATTACTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(466.7) IGHD2-1500(47),IGHD2-2100(47),IGHD6-19*00(40) IGHJ4*00(451.4) nan 442|451|473|0|9||90.0 43|58|93|27|42|SA50CSG51A|47.0;37|52|84|27|42|SG44CST46C|47.0;8|16|63|34|42||40.0 19|37|68|51|69||180.0 nan TGTGCGAAACCGGCAATCCTCCAAAGTTGGTGGTCACTGCTAGGGGGGGATTACTACTTTGACTACTGG 45 CAKPAILQSWWSLLGGDYYFDYW :::::::::0:-2:9:27:-12:-4:42:51:1:69:::
1343 378 0.000228315 40 0.000237538 TGTGCAGCGGGCGTTCTCAGTAGTGGCTACTATCACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-24*00(249.3) IGHD5-1200(51),IGHD5-1800(51) IGHJ4*00(371.4) IGHA100(71.8),IGHA200(71.8) 442|448|473|0|6||60.0 30|43|69|20|33|SG40T|51.0;30|43|69|20|33|SG40T|51.0 23|37|68|34|48||140.0 ; TGTGCAGCGGGCGTTCTCAGTAGTGGCTACTATCACTTTGACTACTGG 45 CAAGVLSSGYYHFDYW :::::::::0:-5:6:20:-7:-3:33:34:-3:48:::
1348 377 0.000227711 44 0.000261292 TGTGCGAGAATCGAGGGCAGCAGCTGGCAATACTCCTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-5900(951.9),IGHV4-6100(951.9) IGHD6-13*00(55) IGHJ4*00(235.6) nan 439|448|470|0|9||90.0;445|454|476|0|9||90.0 28|39|63|16|27||55.0 19|37|68|30|48|SA23C|151.0 nan TGTGCGAGAATCGAGGGCAGCAGCTGGCAATACTCCTTTGACTACTGG 45 CARIEGSSWQYSFDYW :::::::::0:-2:9:16:-7:-3:27:30:1:48:::
1363 373 0.000225295 39 0.0002316 TGTCACTCATTACGATTTTTGAAGTGGACCCCGACCGCATGCATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-5900(329.3),IGHV4-6100(329.3) IGHD3-3*00(81) IGHJ6*00(368.2) IGHG100(97),IGHG200(97),IGHG400(97),IGHGP00(94.5) 439|442|470|0|3||30.0;445|448|476|0|3||30.0 33|52|93|8|27|SG46A|81.0 40|52|83|42|54||120.0 ;;; TGTCACTCATTACGATTTTTGAAGTGGACCCCGACCGCATGCATGGACGTCTGG 45 CHSLRFLKWTPTACMDVW :::::::::0:-8:3:8:-2:-10:27:42:-20:54:::
1367 373 0.000225295 39 0.0002316 TGTGCGAGGTGGGGTAAAGCATCAGGTGGTGTGTTTTCTATTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(808.9),IGHV3-700(808.9) IGHD6-13*00(53) IGHJ4*00(151.6) nan 442|450|473|0|8||80.0;442|450|473|0|8||80.0 21|40|63|11|30|ST26ASG31TSC35G|53.0 26|37|68|40|51||110.0 nan TGTGCGAGGTGGGGTAAAGCATCAGGTGGTGTGTTTTCTATTGACTACTGG 45 CARWGKASGGVFSIDYW :::::::::0:-3:8:11:0:-2:30:40:-6:51:::
1381 371 0.000224087 39 0.0002316 TGTGCGAGAGATGTCTTGCTCGACAGCGGCTGGCACGATTACTATTTTGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-69D*00(303.4) IGHD6-1300(42),IGHD6-1900(42),IGHD6-25*00(40) IGHJ4*00(264.7) nan 442|461|473|0|19|SC454GSC458T|132.0 29|43|63|23|37|SA33GST39C|42.0;29|43|63|23|37|ST32CST39C|42.0;26|34|54|23|31||40.0 19|37|68|39|57|SC24TST31GSA32T|93.0 nan TGTGCGAGAGATGTCTTGCTCGACAGCGGCTGGCACGATTACTATTTTGACGTCTGG 45 CARDVLLDSGWHDYYFDVW :::::::::0:8:19:23:-8:1:37:39:1:57:::
1386 370 0.000223483 37 0.000219723 TGTGTCCGCAGCAACTACTGG NNNNNNNNNNNNNNNNNNNNN IGHV1-8*00(619.1) IGHD6-13*00(30) IGHJ4*00(361.2) nan 442|446|473|0|4||40.0 28|34|63|7|13||30.0 29|37|68|13|21||80.0 nan TGTGTCCGCAGCAACTACTGG 45 CVRSNYW :::::::::0:-7:4:7:-7:-8:13:13:-9:21:::
1395 368 0.000222275 39 0.0002316 TGTGTAAGGGATTTCGTTGGGCCTGTTGAGCGCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(727.1) IGHD3-16*00(25) IGHJ5*00(196.5) nan 442|457|473|0|15|SC446TSA450GSC454T|63.0 52|57|111|16|21||25.0 36|40|71|32|36||40.0 nan TGTGTAAGGGATTTCGTTGGGCCTGTTGAGCGCTGG 45 CVRDFVGPVERW :::::::::0:4:15:16:-15:-17:21:32:-16:36:::
1396 368 0.000222275 36 0.000213784 TGTGGAAGAGATACGGGCGGTTCGGGGGGCCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(105.2),IGHV3-3300(105.2),IGHV3-74*00(104.5) IGHD3-10*00(31) IGHJ500(337),IGHJ400(336) IGHA100(176.1),IGHA200(176.1) 442|454|473|0|12|SC446GSG447A|62.0;442|454|473|0|12|SC446GSG447A|62.0;442|454|473|0|12|SC446G|91.0 41|50|93|18|27|SA46G|31.0 33|40|71|29|36|SC35T|41.0;33|37|68|32|36||40.0 ; TGTGGAAGAGATACGGGCGGTTCGGGGGGCCTCTGG 45 CGRDTGGSGGLW :::::::::0:1:12:18:-10:-12:27:29:-13:36:::
1401 366 0.000221067 38 0.000225661 TGTGCGACAGTAACATATTGTGGTGGTGACTGCTATGGTGCTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(260.4) IGHD2-21*00(92) IGHJ3*00(417) IGHA100(89.3),IGHA200(89.3) 442|452|473|0|10|SG449C|71.0 27|51|84|10|34|SG29AST46C|92.0 19|39|70|34|54|SA22G|171.0 ; TGTGCGACAGTAACATATTGTGGTGGTGACTGCTATGGTGCTTTTGATATCTGG 45 CATVTYCGGDCYGAFDIW :::::::::0:-1:10:10:1:-5:34:34:1:54:::
1402 366 0.000221067 35 0.000207846 TGTGCGAGAGAGAGGGGGAGACTCGTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-5900(915.3),IGHV4-6100(915.3) IGHD3-16*00(35) IGHJ4*00(279.9) nan 439|450|470|0|11||110.0;445|456|476|0|11||110.0 54|61|111|13|20||35.0 26|37|68|25|36||110.0 nan TGTGCGAGAGAGAGGGGGAGACTCGTTGACTACTGG 45 CARERGRLVDYW :::::::::0:0:11:13:-17:-13:20:25:-6:36:::
1435 359 0.000216839 29 0.000172215 TGTGCGAAAGCTGCGGGGAGGTGGCCCCGGTGGTACTTTGAGTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(563.1) IGHD3-1600(30),IGHD4-2300(30),IGHD1-14*00(27) IGHJ4*00(370.8) IGHG100(119),IGHG200(119),IGHG400(119),IGHGP00(119) 442|452|473|0|10||100.0 55|61|111|14|20||30.0;25|31|57|27|33||30.0;0|11|51|20|31|ST4CST5C|27.0 22|37|68|33|48|SC30G|121.0 ;;; TGTGCGAAAGCTGCGGGGAGGTGGCCCCGGTGGTACTTTGAGTACTGG 45 CAKAAGRWPRWYFEYW :::::::::0:-1:10:14:-18:-13:20:33:-2:48:::
1438 358 0.000216235 33 0.000195969 TGTACCACTGATACCCATAGTACCAGGGGCTATTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-15*00(471.2) IGHD2-200(45),IGHD3-1000(40) IGHJ4*00(209.3) IGHA100(169.3),IGHA200(169.3) 448|460|479|0|12|SA456T|91.0 43|52|93|17|26||45.0;19|27|93|14|22||40.0 30|37|68|29|36|SC33T|41.0 ; TGTACCACTGATACCCATAGTACCAGGGGCTATTGG 45 CTTDTHSTRGYW :::::::::0:1:12:17:-12:-10:26:29:-10:36:::
1457 354 0.000213819 38 0.000225661 TGTGTGAAAGGGGGGGGGTTTTTTGGCATTTCTATCGGCGCTGACTACTATTACTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(426.8) IGHD3-300(35),IGHD3-1600(31) IGHJ6*00(413.7) nan 442|452|473|0|10|SC446T|71.0 40|47|93|19|26||35.0;54|63|111|11|20|SA59G|31.0 23|52|83|43|69|SC30TDG37DG38DT39|147.0 nan TGTGTGAAAGGGGGGGGGTTTTTTGGCATTTCTATCGGCGCTGACTACTATTACTACATGGACGTCTGG 45 CVKGGGFFGISIGADYYYYMDVW :::::::::0:-1:10:19:-9:-15:26:43:-3:69:::
1470 351 0.000212007 37 0.000219723 TGTGCGAGACTGCAGTGGGAACTACTTCACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(511.5) IGHD1-26*00(51) IGHJ4*00(407.6) IGHG100(155.9),IGHG200(155.9),IGHG400(155.9),IGHGP00(155.9) 442|452|473|0|10||100.0 25|38|60|13|26|SG32A|51.0 23|37|68|28|42||140.0 ;;; TGTGCGAGACTGCAGTGGGAACTACTTCACTTTGACTACTGG 45 CARLQWELLHFDYW :::::::::0:-1:10:13:-5:-2:26:28:-3:42:::
1471 351 0.000212007 33 0.000195969 TGCGTGAGAGGCCGCGGGGGGACGCGCAGTGGCTGGGGCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-8*00(523.6) IGHD6-19*00(55) IGHJ4*00(183.1) nan 442|455|473|0|13|ST444CSC446T|72.0 28|39|63|25|36||55.0 30|37|68|38|45||70.0 nan TGCGTGAGAGGCCGCGGGGGGACGCGCAGTGGCTGGGGCTACTGG 45 CVRGRGGTRSGWGYW :::::::::0:2:13:25:-7:-3:36:38:-10:45:::
1480 349 0.000210799 39 0.0002316 TGTGGAAGAGATACGGGCGGTTCGGGGAGCCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(961.6) IGHD3-10*00(41) IGHJ500(216.5),IGHJ400(210.7) nan 442|454|473|0|12|SC446G|91.0 41|52|93|18|29|SA46G|41.0 33|40|71|29|36|SC35T|41.0;33|37|68|32|36||40.0 nan TGTGGAAGAGATACGGGCGGTTCGGGGAGCCTCTGG 45 CGRDTGGSGSLW :::::::::0:1:12:18:-10:-10:29:29:-13:36:::
1489 346 0.000208987 36 0.000213784 TGTGCGAGTTCTTACGGTGACCAGTTCTACTTTGAGTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-31*00(340.1) IGHD4-17*00(45) IGHJ4*00(365.8) IGHA100(142.8),IGHA200(142.8) 445|453|476|0|8||80.0 20|29|48|12|21||45.0 17|37|68|22|42|SA20TSC30GSA32C|113.0 ; TGTGCGAGTTCTTACGGTGACCAGTTCTACTTTGAGTCCTGG 45 CASSYGDQFYFESW :::::::::0:-3:8:12:-4:-3:21:22:3:42:::
1502 343 0.000207175 33 0.000195969 TGTGTAACTTCGGGGTGGCTAGAGCGATCCTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(276) IGHD5-1200(35),IGHD5-1800(35),IGHD5-24*00(30) IGHJ400(343.7),IGHJ500(342.7) IGHM*00(176.6) 442|449|473|0|7|SC446T|41.0 32|39|69|14|21||35.0;32|39|69|14|21||35.0;27|33|60|15|21||30.0 30|37|68|29|36|SA32T|41.0;36|40|71|32|36||40.0 nan TGTGTAACTTCGGGGTGGCTAGAGCGATCCTTCTGG 45 CVTSGWLERSFW :::::::::0:-4:7:14:-9:-7:21:29:-10:36:::
1507 343 0.000207175 31 0.000184092 TGTGCGAGGTCTCGTCCATATTCCGATTTTTGGAGTGGTGGGGCCAAAAATTCTTTTGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(368.5) IGHD3-3*00(91) IGHJ3*00(330.5) IGHA100(40.1),IGHA200(40.1) 445|453|476|0|8||80.0 32|53|93|18|39|SA36C|91.0 22|39|70|49|66|SG24TSA33C|112.0 ; TGTGCGAGGTCTCGTCCATATTCCGATTTTTGGAGTGGTGGGGCCAAAAATTCTTTTGATCTCTGG 45 CARSRPYSDFWSGGAKNSFDLW :::::::::0:-3:8:18πŸ‘Ž-9:39:49:-2:66:::
1514 341 0.000205967 37 0.000219723 TGTGTAAAAGACGGAATTGACCGTGCTTTTGACATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(582.6) IGHD2-2100(30),IGHD5-2400(26) IGHJ3*00(253.9) nan 442|453|473|0|11|SC446TSG449A|52.0 55|61|84|11|17||30.0;39|47|60|11|19|ST41G|26.0 23|39|70|23|39|ST32C|131.0 nan TGTGTAAAAGACGGAATTGACCGTGCTTTTGACATCTGG 45 CVKDGIDRAFDIW :::::::::0:0:11:11:-27:5:17:23:-3:39:::
1516 341 0.000205967 31 0.000184092 TGTGCGCGAGAGGTAAAAGCAGCAGGTGACAGTGATGCTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-31*00(449.7) IGHD6-1300(41),IGHD2-200(36) IGHJ3*00(464.6) IGHG100(112.7),IGHG200(112.7),IGHG400(112.7),IGHGP00(112.7) 445|456|476|0|11|SA451C|81.0 27|38|63|17|28|SC35G|41.0;5|15|93|17|27|ST11A|36.0 20|39|70|32|51||190.0 ;;; TGTGCGCGAGAGGTAAAAGCAGCAGGTGACAGTGATGCTTTTGATATCTGG 45 CAREVKAAGDSDAFDIW :::::::::0:0:11:17:-6:-4:28:32:0:51:::
1538 338 0.000204154 40 0.000237538 TGTGCGAGAGACATTAACATTGTGGATGCCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-11*00(807.1) IGHD2-2100(35),IGHD3-1600(31) IGHJ4*00(186.2) nan 442|453|473|0|11||110.0 33|40|84|18|25||35.0;45|56|111|12|25|I48AI53G|31.0 27|37|68|26|36|SA29C|71.0 nan TGTGCGAGAGACATTAACATTGTGGATGCCTACTGG 45 CARDINIVDAYW :::::::::0:0:11:18:-5:-16:25:26:-7:36:::
1542 337 0.00020355 35 0.000207846 TGTGCGAGACCAGCTGGAACTACAAGATTCGACGATGCTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(994.3) IGHD2-200(51),IGHD1-700(50) IGHJ3*00(237.7) nan 442|452|473|0|10||100.0 7|20|93|10|23|ST14A|51.0;24|34|51|13|23||50.0 21|39|70|33|51||180.0 nan TGTGCGAGACCAGCTGGAACTACAAGATTCGACGATGCTTTTGATATCTGG 45 CARPAGTTRFDDAFDIW :::::::::0:-1:10:10:24:-42:23:33πŸ‘Ž51:::
1557 335 0.000202342 32 0.000190031 TGTGCAAGGGGGCCCGGGCTCTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(997.2) IGHD5-2400(30),IGHD6-1300(30),IGHD6-25*00(30) IGHJ6*00(271.6) nan 442|450|473|0|8||80.0 14|20|60|18|24||30.0;18|24|63|12|18||30.0;15|21|54|12|18||30.0 40|52|83|24|36||120.0 nan TGTGCAAGGGGGCCCGGGCTCTACATGGACGTCTGG 45 CARGPGLYMDVW :::::::::0:-3:8:18:6:-20:24:24:-20:36:::
1568 333 0.000201134 31 0.000184092 TGTGTAAGAGTGTTAAGCGACTGG NNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(814.6) nan IGHJ4*00(349.4) nan 442|452|473|0|10|SC446T|71.0 nan 32|37|68|19|24||50.0 nan TGTGTAAGAGTGTTAAGCGACTGG 45 CVRVLSDW :::::::::0:-1:10:::::19:-12:24:::
1577 332 0.00020053 33 0.000195969 TGTGCGACTGCTAAGGTAGTAGTCCTACCGTATGTTAGCTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(386.9) IGHD2-200(40),IGHD1-2600(39),IGHD3-22*00(37) IGHJ5*00(401.9) IGHG100(94.5),IGHG200(94.5),IGHG400(94.5),IGHGP00(94.5) 445|452|476|0|7||70.0 39|47|93|15|23||40.0;0|14|60|15|28|DC7SC11T|39.0;37|50|93|10|23|ST40ASA42G|37.0 24|40|71|38|54||160.0 ;;; TGTGCGACTGCTAAGGTAGTAGTCCTACCGTATGTTAGCTGGTTCGACCCCTGG 45 CATAKVVVLPYVSWFDPW :::::::::0:-4:7:15:-8:-15:23:38:-4:54:::
1584 330 0.000199322 31 0.000184092 TGTTCGAGGCGACATAGCAGTGGGTGGTATGAATCTGGGGGCGTACACTGGCACTTGGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-400(242.3),IGHV4-5500(242.3) IGHD6-19*00(66) IGHJ2*00(372.9) IGHG100(37.2),IGHG200(37.2),IGHG400(37.2),IGHGP00(37.2) 442|450|473|0|8|SG445T|51.0;442|450|473|0|8|SG445T|51.0 25|41|63|13|29|SC35G|66.0 22|42|73|46|66|ST27CSC32G|142.0 ;;; TGTTCGAGGCGACATAGCAGTGGGTGGTATGAATCTGGGGGCGTACACTGGCACTTGGATCTCTGG 45 CSRRHSSGWYESGGVHWHLDLW :::::::::0:-3:8:13:-4:-1:29:46:-2:66:::
1590 330 0.000199322 32 0.000190031 TGTGCCAAAGATTTCATAGTGGCTATTGACTTCGGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(817.2) IGHD5-1200(50),IGHD5-1800(50) IGHJ4*00(199.1) nan 442|454|473|0|12|SG447C|91.0 29|39|69|15|25||50.0;29|39|69|15|25||50.0 26|37|68|25|36|SA32TST34G|52.0 nan TGTGCCAAAGATTTCATAGTGGCTATTGACTTCGGG 45 CAKDFIVAIDFG :::::::::0:1:12:15:-6:-7:25:25:-6:36:::
1614 326 0.000196906 32 0.000190031 TGTGTAACGGACTTTCCCTTCGATGCGGGGAGTTATAGTTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(751.2) IGHD3-1600(51),IGHD3-1000(45) IGHJ4*00(161.5) nan 442|449|473|0|7|SC446T|41.0 55|68|111|26|39|SC65A|51.0;47|56|93|27|36||45.0 25|37|68|39|51||120.0 nan TGTGTAACGGACTTTCCCTTCGATGCGGGGAGTTATAGTTTTGACTACTGG 45 CVTDFPFDAGSYSFDYW :::::::::0:-4:7:26:-18:-6:39:39:-5:51:::
1616 326 0.000196906 33 0.000195969 TGTGCGAGGCATAACCTAGTAGACGAGTGGGCCGCTGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(843.8),IGHV3-700(843.8) IGHD3-1000(33),IGHD3-900(33),IGHD2-15*00(31) IGHJ4*00(163.4) nan 442|450|473|0|8||80.0;442|450|473|0|8||80.0 17|27|93|12|21|DA21|33.0;6|15|93|10|20|I12T|33.0;24|33|93|10|19|ST27A|31.0 27|37|68|35|45|ST31C|71.0 nan TGTGCGAGGCATAACCTAGTAGACGAGTGGGCCGCTGACCACTGG 45 CARHNLVDEWAADHW :::::::::0:-3:8:12:14:-35:21:35:-7:45:::
1619 325 0.000196302 38 0.000225661 TGTGCGAAGATTATTGTCCCTAATCCTAGCTACTTCTTTAACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(883) IGHD5-1200(36),IGHD5-1800(36),IGHD2-15*00(35) IGHJ4*00(163.6) nan 442|450|473|0|8||80.0 1|11|69|20|30|SG6C|36.0;1|11|69|20|30|SG6C|36.0;26|33|93|22|29||35.0 19|37|68|30|48|SA23TSG28ASA32C|93.0 nan TGTGCGAAGATTATTGTCCCTAATCCTAGCTACTTCTTTAACTCCTGG 45 CAKIIVPNPSYFFNSW :::::::::0:-3:8:20:22:-35:30:30:1:48:::
1624 324 0.000195698 35 0.000207846 TGTGCGAGAGGTTCCACGGCCTACTTTGACTATTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-11*00(773.2) IGHD1-700(30),IGHD5-1200(30),IGHD5-5*00(30) IGHJ4*00(282.4) nan 442|452|473|0|10||100.0 3|9|51|10|16||30.0;18|24|69|12|18||30.0;15|21|60|12|18||30.0 21|37|68|20|36|SC33T|131.0 nan TGTGCGAGAGGTTCCACGGCCTACTTTGACTATTGG 45 CARGSTAYFDYW :::::::::0:-1:10:10:14:-25:16:20πŸ‘Ž36:::
1631 323 0.000195094 35 0.000207846 TGTGCGGCAGACCCCTACCCCCGGTCTGGCCCCTGGTACTTCGATGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-48*00(460.1) IGHD2-1500(26),IGHD3-2200(26),IGHD4-23*00(26) IGHJ2*00(199.4) nan 442|448|473|0|6||60.0 10|18|93|14|22|SA15C|26.0;9|17|93|10|18|SA12C|26.0;5|13|57|15|23|SA9C|26.0 23|42|73|32|51|SC36G|161.0 nan TGTGCGGCAGACCCCTACCCCCGGTCTGGCCCCTGGTACTTCGATGTCTGG 45 CAADPYPRSGPWYFDVW :::::::::0:-5:6:14:21:-44:22:32:-3:51:::
1637 322 0.00019449 33 0.000195969 TGTGCGAGAGATCGTCGTAACGCTGACTGCGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-48*00(920.8) IGHD4-1700(31),IGHD3-300(30),IGHD5-5*00(30) IGHJ5*00(229.1) nan 442|455|473|0|13||130.0 21|30|48|19|28|SG24C|31.0;22|28|93|14|20||30.0;39|45|60|15|21||30.0 30|40|71|29|39|SC34T|71.0 nan TGTGCGAGAGATCGTCGTAACGCTGACTGCGACTCCTGG 45 CARDRRNADCDSW :::::::::0:2:13:19:-5:-2:28:29:-10:39:::
1646 321 0.000193886 42 0.000249415 TGTGCGAAAGGGGGTGCTCTTAACTACTACTATTACATGGACGTCTGC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(881) nan IGHJ6*00(156.6) nan 442|452|473|0|10||100.0 nan 23|52|83|22|48|SC33TDG37DG38DT39SG51C|118.0 nan TGTGCGAAAGGGGGTGCTCTTAACTACTACTATTACATGGACGTCTGC 45 CAKGGALNYYYYMDVC :::::::::0:-1:10:::::22:-3:48:::
1649 320 0.000193282 36 0.000213784 TGTGCGAGACATCATGAGTTGGTTCGGGGTATTATTGGTTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(740.9) IGHD3-10*00(44) IGHJ5*00(176.9) nan 445|457|476|0|12||120.0 40|59|93|19|35|DA46DA50DT52|44.0 25|40|71|39|54||150.0 nan TGTGCGAGACATCATGAGTTGGTTCGGGGTATTATTGGTTGGTTCGACCCCTGG 45 CARHHELVRGIIGWFDPW :::::::::0:1:12:19:-9:-3:35:39:-5:54:::
1650 320 0.000193282 37 0.000219723 TGTGCGAGAACTTTCGACTACAATAACTATTCCCCTGTCGACTGTTATTTTGATGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-400(362.7),IGHV4-5500(362.7) IGHD4-1100(56),IGHD4-400(56) IGHJ2*00(296.2) IGHA100(61.8),IGHA200(61.8) 442|451|473|0|9||90.0;442|451|473|0|9||90.0 17|31|48|15|29|SG24A|56.0;17|31|48|15|29|SG24A|56.0 22|42|73|40|60|SG26TSC29TSC32TSC36G|84.0 ; TGTGCGAGAACTTTCGACTACAATAACTATTCCCCTGTCGACTGTTATTTTGATGTCTGG 45 CARTFDYNNYSPVDCYFDVW :::::::::0:-2:9:15πŸ‘Ž-1:29:40:-2:60:::
1651 320 0.000193282 36 0.000213784 TGTATGACAGATCCCTTTTCCTATGATACAATTGGGGGGGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-15*00(754.8) IGHD3-16*00(59) IGHJ5*00(71.2) nan 448|461|479|0|13|SC452TSC453G|72.0 41|59|111|21|38|DT46ST51A|59.0 31|40|71|39|48|SC34T|61.0 nan TGTATGACAGATCCCTTTTCCTATGATACAATTGGGGGGGACTCCTGG 45 CMTDPFSYDTIGGDSW :::::::::0:2:13:21:-4:-15:38:39:-11:48:::
1654 319 0.000192678 29 0.000172215 TGTGCGAGAACGATAGCAGCAGCTGGTTTAGACCACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-53*00(906.1) IGHD6-13*00(75) IGHJ4*00(199.3) nan 439|448|470|0|9||90.0 25|40|63|12|27||75.0 20|37|68|31|48|ST22C|141.0 nan TGTGCGAGAACGATAGCAGCAGCTGGTTTAGACCACTTTGACTACTGG 45 CARTIAAAGLDHFDYW :::::::::0:-2:9:12:-4:-2:27:31:0:48:::
1675 316 0.000190866 35 0.000207846 TGTGCGAAACGTAGAGGGGGGGAACAACCAGACTGGGACTTTGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(435.3) IGHD5-2400(35),IGHD3-900(31),IGHD3-16*00(30) IGHJ4*00(413.3) IGHG100(102.9),IGHG200(102.9),IGHG400(102.9),IGHGP00(102.9) 442|451|473|0|9||90.0 19|26|60|9|16||35.0;5|14|93|22|31|ST7C|31.0;54|60|111|17|23||30.0 23|37|68|37|51|ST31C|111.0 ;;; TGTGCGAAACGTAGAGGGGGGGAACAACCAGACTGGGACTTTGACCACTGG 45 CAKRRGGEQPDWDFDHW :::::::::0:-2:9:9:1:-14:16:37:-3:51:::
1676 316 0.000190866 39 0.0002316 TGTGCGAAAGTGGCAGGACCCAACAGTGTGACCATTCACCCCAATTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(479.2) IGHD2-2100(31),IGHD3-1600(30),IGHD5-18*00(30) IGHJ4*00(364.8) IGHM*00(102.8) 442|452|473|0|10||100.0 14|23|84|36|45|SA18C|31.0;16|22|111|38|44||30.0;17|23|69|33|39||30.0 31|37|68|45|51||60.0 nan TGTGCGAAAGTGGCAGGACCCAACAGTGTGACCATTCACCCCAATTACTGG 45 CAKVAGPNSVTIHPNYW :::::::::0:-1:10:36:14:-33:45:45:-11:51:::
1682 315 0.000190262 33 0.000195969 TGTGCGAGAATAGCTGTGGCTGACAGGGGGTTCGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(920.1),IGHV3-700(920.1) IGHD6-19*00(51) IGHJ4*00(218.3) nan 442|451|473|0|9||90.0;442|451|473|0|9||90.0 25|38|63|9|22|SA30T|51.0 25|37|68|30|42|ST27C|91.0 nan TGTGCGAGAATAGCTGTGGCTGACAGGGGGTTCGACTACTGG 45 CARIAVADRGFDYW :::::::::0:-2:9:9:-4:-4:22:30:-5:42:::
1689 314 0.000189658 31 0.000184092 TGTGCTCGGATTGTTCGGGATGACTACGGTGACTATTACGCTTACAACGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-70*00(487.6) IGHD4-17*00(80) IGHJ6*00(455.6) IGHA100(55.1),IGHA200(55.1) 445|456|478|0|11|SA450T|81.0 15|31|48|19|35||80.0 31|52|83|42|63|ST34A|181.0 ; TGTGCTCGGATTGTTCGGGATGACTACGGTGACTATTACGCTTACAACGGTATGGACGTCTGG 45 CARIVRDDYGDYYAYNGMDVW :::::::::0:-2:11:19:1:-1:35:42:-11:63:::
1700 312 0.00018845 32 0.000190031 TGTGCGAGTGAGAATGGTGGCCACGCTAACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(407.2) IGHD6-1900(33),IGHD5-1200(32),IGHD5-18*00(32) IGHJ4*00(383.6) IGHG100(150.4),IGHG200(150.4),IGHG400(150.4),IGHGP00(150.4) 445|453|476|0|8||80.0 6|16|63|19|28|DT11|33.0;2|14|69|12|24|SC5GSA8G|32.0;2|14|69|12|24|SC5GSA8G|32.0 23|37|68|28|42||140.0 ;;; TGTGCGAGTGAGAATGGTGGCCACGCTAACTTTGACTACTGG 45 CASENGGHANFDYW :::::::::0:-3:8:19:15:-26:28:28:-3:42:::
1706 311 0.000187846 30 0.000178154 TGTGCGAGAGGGATCAGTTACTACTACGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(356) IGHD7-27*00(25) IGHJ6*00(518.6) IGHM*00(147.4) 442|452|473|0|10|SA449G|71.0 19|24|33|10|15||25.0 28|52|83|18|42||240.0 nan TGTGCGAGAGGGATCAGTTACTACTACGGTATGGACGTCTGG 45 CARGISYYYGMDVW :::::::::0:-1:10:10:-8:2:15:18:-8:42:::
1707 311 0.000187846 31 0.000184092 TGTGCGAAAGCTGCGGGGAGGTGGCCCCGGTGGTACTTTGAGTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(947.2) IGHD3-1600(30),IGHD4-2300(30),IGHD1-14*00(27) IGHJ4*00(176.2) nan 442|452|473|0|10||100.0 55|61|111|14|20||30.0;25|31|57|27|33||30.0;0|11|51|20|31|ST4CST5C|27.0 22|37|68|33|48|SC30G|121.0 nan TGTGCGAAAGCTGCGGGGAGGTGGCCCCGGTGGTACTTTGAGTACTGG 45 CAKAAGRWPRWYFEYW :::::::::0:-1:10:14:-18:-13:20:33:-2:48:::
1714 309 0.000186638 29 0.000172215 TGTTCGAGAGATGGTTCGGACTGG NNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(881.2),IGHV3-700(881.2) IGHD1-1400(25),IGHD3-1000(25) IGHJ3*00(329.5) nan 442|454|473|0|12|SG445T|91.0;442|454|473|0|12|SG445T|91.0 2|7|51|12|17||25.0;41|46|93|12|17||25.0 35|39|70|20|24||40.0 nan TGTTCGAGAGATGGTTCGGACTGG 45 CSRDGSDW :::::::::0:1:12:12:15:-27:17:20:-15:24:::
1719 309 0.000186638 28 0.000166277 TGTGCGACATTACGAGTGGCCCAAGTCCAGCCCCAACGTTACATCTTCTATGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(551.7) IGHD3-1000(35),IGHD3-300(35),IGHD3-9*00(35) IGHJ6*00(273.6) nan 442|449|473|0|7||70.0 59|66|93|34|41||35.0;33|40|93|8|15||35.0;33|40|93|8|15||35.0 30|52|83|44|66|SA32TSC36T|162.0 nan TGTGCGACATTACGAGTGGCCCAAGTCCAGCCCCAACGTTACATCTTCTATGGTATGGACGTCTGG 45 CATLRVAQVQPQRYIFYGMDVW :::::::::0:-4:7:34:-28:4:41:44:-10:66:::
1731 308 0.000186034 30 0.000178154 TGTGCGATAAATCACATCTCGTCTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-18*00(650.6) IGHD6-600(31),IGHD5-2400(30) IGHJ4*00(398.7) IGHA100(75.6),IGHA200(75.6) 442|455|473|0|13|SG449TSG451A|72.0 26|35|54|14|23|SG28T|31.0;11|17|60|14|20||30.0 27|37|68|23|33||100.0 ; TGTGCGATAAATCACATCTCGTCTGACTACTGG 45 CAINHISSDYW :::::::::0:2:13:14:-8:-1:23:23:-7:33:::
1732 308 0.000186034 28 0.000166277 TGTGCGAGAGACCACAGTCAGAACTATGATTCGGGGACTTATTGGTGGCTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-46*00(667.8) IGHD3-10*00(63) IGHJ5*00(244.2) nan 442|453|473|0|11||110.0 36|57|93|22|43|SG42ASA46GSG51C|63.0 25|40|71|45|60|ST28C|121.0 nan TGTGCGAGAGACCACAGTCAGAACTATGATTCGGGGACTTATTGGTGGCTCGACCCCTGG 45 CARDHSQNYDSGTYWWLDPW :::::::::0:0:11:22:-5:-5:43:45:-5:60:::
1760 305 0.000184222 34 0.000201907 TGTGCCAGAGCGGGAGGTACCTACTCCGACGCCGTGTTTGCCATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-30-2*00(461.1) IGHD2-1500(40),IGHD1-2600(34) IGHJ4*00(315.4) IGHA100(124.1),IGHA200(124.1) 445|455|476|0|10||100.0 55|63|93|20|28||40.0;28|40|60|11|24|SC33GI36C|34.0 33|37|68|44|48||40.0 ; TGTGCCAGAGCGGGAGGTACCTACTCCGACGCCGTGTTTGCCATCTGG 45 CARAGGTYSDAVFAIW :::::::::0:-1:10:20:-24:1:28:44:-13:48:::
1766 304 0.000183618 27 0.000160338 TGTGCGAAAGAAATTCGTCCAAATGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(300.7) IGHD3-300(30),IGHD6-600(30) IGHJ4*00(266.1) IGHA1*00(192.9) 442|453|473|0|11||110.0 14|20|93|17|23||30.0;30|36|54|14|20||30.0 27|37|68|23|33|SA32T|71.0 nan TGTGCGAAAGAAATTCGTCCAAATGACTTCTGG 45 CAKEIRPNDFW :::::::::0:0:11:17:17:-42:23:23:-7:33:::
1775 303 0.000183014 34 0.000201907 TGTACCACAGATAACTTTGGTAGTAGCGGTTACCGTCCCGATGCTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-15*00(531) IGHD3-22*00(53) IGHJ3*00(452.9) IGHA100(73.9),IGHA200(73.9) 448|460|479|0|12||120.0 36|55|93|13|32|SA39TSA42GST49C|53.0 21|39|70|39|57||180.0 ; TGTACCACAGATAACTTTGGTAGTAGCGGTTACCGTCCCGATGCTTTTGATATCTGG 45 CTTDNFGSSGYRPDAFDIW :::::::::0:1:12:13:-5:-7:32:39πŸ‘Ž57:::
1780 302 0.00018241 26 0.0001544 TGTGCACGGGCCGGTTCGTATAGTGGCAGCTACTACCTTGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-26*00(352.7) IGHD1-2600(51),IGHD5-1200(45),IGHD5-18*00(45) IGHJ4*00(402.9) IGHM*00(125.4) 445|454|478|0|9||90.0 21|34|60|17|30|SG30C|51.0;28|37|69|18|27||45.0;28|37|69|18|27||45.0 19|37|68|30|48|ST25CST31C|122.0 nan TGTGCACGGGCCGGTTCGTATAGTGGCAGCTACTACCTTGACCACTGG 45 CARAGSYSGSYYLDHW :::::::::0:-4:9:17πŸ‘Ž-6:30:30:1:48:::
1786 301 0.000181806 32 0.000190031 TGTGCGAGAGATTCCGCGTCACATTGTAATTACCATTGTTCTTCCAGGGGGTTTGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-1100(252),IGHV3-7100(252) IGHD3-1000(37),IGHD3-2200(36),IGHD3-9*00(33) IGHJ4*00(368.2) IGHG100(43.8),IGHGP00(43.8) 442|454|473|0|12||120.0;448|460|479|0|12||120.0 33|46|93|28|41|ST38CSG41T|37.0;3|13|93|25|35|SA8T|36.0;60|75|93|20|35|SG62ASA65GSA70T|33.0 25|37|68|51|63|SA32T|91.0 ; TGTGCGAGAGATTCCGCGTCACATTGTAATTACCATTGTTCTTCCAGGGGGTTTGACTTCTGG 45 CARDSASHCNYHCSSRGFDFW :::::::::0:1:12:28:-2:-16:41:51:-5:63:::
1793 300 0.000181202 31 0.000184092 TGTGCGAAAGACTTTGGTCCGTATAGCGGGAGGTATTACGACGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(500.8) IGHD1-26*00(46) IGHJ6*00(457) IGHG100(74.4),IGHG200(74.4),IGHG400(74.4),IGHGP00(74.4) 442|453|473|0|11||110.0 21|33|60|20|32|ST27C|46.0 28|52|83|33|57|SC30TST34G|182.0 ;;; TGTGCGAAAGACTTTGGTCCGTATAGCGGGAGGTATTACGACGGTATGGACGTCTGG 45 CAKDFGPYSGRYYDGMDVW :::::::::0:0:11:20πŸ‘Ž-7:32:33:-8:57:::
1803 299 0.000180598 31 0.000184092 TGTGCGAAAGGTGGTTACTGTGGTTCGGGGAGTAATTATAATGAGCGCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(511.7) IGHD3-10*00(93) IGHJ4*00(378) IGHM*00(89) 442|452|473|0|10||100.0 34|61|93|14|41|SA39GSA46GST53A|93.0 30|37|68|47|54||70.0 nan TGTGCGAAAGGTGGTTACTGTGGTTCGGGGAGTAATTATAATGAGCGCTACTGG 45 CAKGGYCGSGSNYNERYW :::::::::0:-1:10:14:-3:-1:41:47:-10:54:::
1811 298 0.000179994 31 0.000184092 TGTACGAGAGATCTAGCCAAGGGAGCCCAACTCGAAGATGCTTTTGATGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-2*00(803.6) IGHD1-100(31),IGHD1-2600(30),IGHD3-10*00(30) IGHJ3*00(239.8) nan 442|456|473|0|14|SG445A|111.0 21|30|51|27|36|SG26C|31.0;28|34|60|20|26||30.0;46|52|93|19|25||30.0 21|39|70|36|54|SA33G|151.0 nan TGTACGAGAGATCTAGCCAAGGGAGCCCAACTCGAAGATGCTTTTGATGTCTGG 45 CTRDLAKGAQLEDAFDVW :::::::::0:3:14:27:-4:-4:36:36πŸ‘Ž54:::
1822 297 0.00017939 28 0.000166277 TGTACGAGACAACACGCCGGCTGGTTTTGGGCCGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(351.1) IGHD6-1900(35),IGHD3-300(30),IGHD6-13*00(30) IGHJ5*00(292) IGHD*00(158.1) 445|456|476|0|11|SG448A|81.0 33|40|63|18|25||35.0;41|47|93|24|30||30.0;34|40|63|19|25||30.0 30|40|71|32|42|SC34T|71.0 nan TGTACGAGACAACACGCCGGCTGGTTTTGGGCCGACTCCTGG 45 CTRQHAGWFWADSW :::::::::0:0:11:18:-12:-2:25:32:-10:42:::
1828 296 0.000178786 34 0.000201907 TGTGTCAAAGGCTTTAGCAGCTCGTCTCGCAGCCACTTTGACAACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-43*00(661.5) IGHD6-6*00(60) IGHJ4*00(163) nan 442|452|475|0|10|SC446TSA447C|42.0 23|35|54|14|26||60.0 23|37|68|34|48|ST31A|111.0 nan TGTGTCAAAGGCTTTAGCAGCTCGTCTCGCAGCCACTTTGACAACTGG 45 CVKGFSSSSRSHFDNW :::::::::0:-3:10:14:-5:-1:26:34:-3:48:::
1832 296 0.000178786 27 0.000160338 TGTGCGACAGATGGGGGCGGCTCGGCGGCATTTGATGCTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-33*00(929.3) IGHD2-200(30),IGHD6-2500(30),IGHD6-6*00(26) IGHJ3*00(223.2) nan 442|454|473|0|12|SG449C|91.0 61|67|93|25|31||30.0;28|34|54|16|22||30.0;25|33|54|16|24|SA27G|26.0 20|39|70|32|51||190.0 nan TGTGCGACAGATGGGGGCGGCTCGGCGGCATTTGATGCTTTTGATATCTGG 45 CATDGGGSAAFDAFDIW :::::::::0:1:12:25:-30:5:31:32:0:51:::
1841 295 0.000178182 27 0.000160338 TGCGCGAGAGTGTCGGGGGCGTTGGGGCGAGATGCTTGTGATGTGTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-34*00(401) IGHD3-16*00(31) IGHJ3*00(347.9) IGHA100(125.6),IGHA200(125.6) 439|449|470|0|10|ST441C|71.0 54|63|111|14|23|SA59C|31.0 21|39|70|30|48|ST28GSA33GSC35G|93.0 ; TGCGCGAGAGTGTCGGGGGCGTTGGGGCGAGATGCTTGTGATGTGTGG 45 CARVSGALGRDACDVW :::::::::0:-1:10:14:-17:-11:23:30πŸ‘Ž48:::
1845 294 0.000177578 29 0.000172215 TGTGCGAGAACGATAGCAGCAGCTGGTTTAGACCACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-53*00(290.7) IGHD6-13*00(75) IGHJ4*00(428.4) IGHA100(116.7),IGHA200(116.7) 439|448|470|0|9||90.0 25|40|63|12|27||75.0 20|37|68|31|48|ST22C|141.0 ; TGTGCGAGAACGATAGCAGCAGCTGGTTTAGACCACTTTGACTACTGG 45 CARTIAAAGLDHFDYW :::::::::0:-2:9:12:-4:-2:27:31:0:48:::
1872 291 0.000175766 26 0.0001544 TGTGCGAAAGCGGAAGGAGAAGGCTTCCGTTTAGGGAGAGGTTTCAATCGGTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-59*00(383.9) IGHD3-1000(36),IGHD3-300(31),IGHD5-24*00(31) IGHJ5*00(423.8) IGHA100(40),IGHA200(40) 439|449|470|0|10|SG446A|71.0 42|52|93|28|38|SC45T|36.0;45|54|93|34|43|ST49A|31.0;23|32|60|16|25|ST27A|31.0 25|40|71|51|66||150.0 ; TGTGCGAAAGCGGAAGGAGAAGGCTTCCGTTTAGGGAGAGGTTTCAATCGGTGGTTCGACCCCTGG 45 CAKAEGEGFRLGRGFNRWFDPW :::::::::0:-1:10:28:-11:-10:38:51:-5:66:::
1886 289 0.000174558 27 0.000160338 TGTGCGAAACGACCTAGCAGCAGCTGGTATTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(877.8) IGHD6-13*00(65) IGHJ4*00(241.9) nan 442|451|473|0|9||90.0 26|39|63|14|27||65.0 22|37|68|27|42|SC24T|121.0 nan TGTGCGAAACGACCTAGCAGCAGCTGGTATTTTGACTACTGG 45 CAKRPSSSWYFDYW :::::::::0:-2:9:14:-5:-3:27:27:-2:42:::
1890 288 0.000173954 37 0.000219723 TGTGTTCGAGGGCACCAAGGGTATGTGATTAGTAGTGATTCCACTAACACTTGGCACTACCACTACTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-72*00(327.8) IGHD3-22*00(44) IGHJ6*00(290.3) nan 448|458|479|0|10|SC452TSA454C|42.0 40|54|93|25|40|I43TSG51A|44.0 23|52|83|55|81|ST28CDG37DG38DT39|147.0 nan TGTGTTCGAGGGCACCAAGGGTATGTGATTAGTAGTGATTCCACTAACACTTGGCACTACCACTACTACATGGACGTCTGG 45 CVRGHQGYVISSDSTNTWHYHYYMDVW :::::::::0:-1:10:25:-9:-8:40:55:-3:81:::
1894 288 0.000173954 31 0.000184092 TGTGCGACAGAAAAGGAGTATTACGGTCTTTCGACTGGATTTTCCCAGTACTACTTTGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(289.7) IGHD3-9*00(63) IGHJ4*00(445.4) nan 442|453|473|0|11|SG449C|81.0 31|52|93|17|38|SA39GSA41CST45C|63.0 17|37|68|46|66|ST31C|171.0 nan TGTGCGACAGAAAAGGAGTATTACGGTCTTTCGACTGGATTTTCCCAGTACTACTTTGACCACTGG 45 CATEKEYYGLSTGFSQYYFDHW :::::::::0:0:11:17:0:-10:38:46:3:66:::
1901 287 0.00017335 38 0.000225661 TGTGTCAGATCTATGCAATTCATTTATGACATTGACTATTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(613.9),IGHV3-700(613.9) IGHD2-200(30),IGHD3-1600(28),IGHD2-21*00(26) IGHJ4*00(183.1) nan 442|446|473|0|4||40.0;442|446|473|0|4||40.0 55|61|93|10|16||30.0;45|54|111|17|25|DA48|28.0;47|55|84|13|21|ST50A|26.0 23|37|68|28|42|ST25ASC33T|82.0 nan TGTGTCAGATCTATGCAATTCATTTATGACATTGACTATTGG 45 CVRSMQFIYDIDYW :::::::::0:-7:4:10:-24:-1:16:28:-3:42:::
1911 286 0.000172746 27 0.000160338 TGTGCGAGACGGGTCACGGTGTTGACACCTCACTACTACCTGTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(338) IGHD2-200(40),IGHD3-2200(40),IGHD1-26*00(39) IGHJ6*00(379.1) IGHA100(82.2),IGHA200(82.2) 445|455|476|0|10||100.0 15|23|93|31|39||40.0;11|19|93|30|38||40.0;11|24|60|30|44|I16CSG20T|39.0 40|52|83|45|57||120.0 ; TGTGCGAGACGGGTCACGGTGTTGACACCTCACTACTACCTGTACATGGACGTCTGG 45 CARRVTVLTPHYYLYMDVW :::::::::0:-1:10:31:16:-39:39:45:-20:57:::
1921 285 0.000172142 32 0.000190031 TGTGCGAAAGGGATCAGTAACTTCTACGGTTTGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(921.8) IGHD4-1100(25),IGHD4-400(25),IGHD7-27*00(25) IGHJ6*00(296.4) nan 442|452|473|0|10||100.0 22|27|48|14|19||25.0;22|27|48|14|19||25.0;19|24|33|10|15||25.0 29|52|83|19|42|SA32TSA40T|172.0 nan TGTGCGAAAGGGATCAGTAACTTCTACGGTTTGGACGTCTGG 45 CAKGISNFYGLDVW :::::::::0:-1:10:14:-6:-5:19:19:-9:42:::
1925 284 0.000171538 28 0.000166277 TGTGCGGGCCGCCATGCTTACTACGGTGCCCGTTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(411.4) IGHD4-1700(45),IGHD4-2300(45),IGHD3-22*00(40) IGHJ4*00(424) IGHM*00(130.3) 445|451|476|0|6||60.0 18|27|48|19|28||45.0;21|30|57|19|28||45.0;55|63|93|17|25||40.0 25|37|68|33|45||120.0 nan TGTGCGGGCCGCCATGCTTACTACGGTGCCCGTTTTGACTACTGG 45 CAGRHAYYGARFDYW :::::::::0:-5:6:19:-2:-5:28:33:-5:45:::
1926 284 0.000171538 30 0.000178154 TGTGCGAGAGAAGTTAATGGCTTTGATGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-69D00(492.1),IGHV1-800(482.1) IGHD4-1100(26),IGHD4-400(26),IGHD3-10*00(25) IGHJ3*00(303.4) IGHA100(145.7),IGHA200(145.7) 442|453|473|0|11||110.0;442|452|473|0|10||100.0 2|10|48|11|19|SC7A|26.0;2|10|48|11|19|SC7A|26.0;50|55|93|11|16||25.0 27|39|70|21|33|SA33G|91.0 ; TGTGCGAGAGAAGTTAATGGCTTTGATGTCTGG 45 CAREVNGFDVW :::::::::0:0:11:11:14:-22:19:21:-7:33:::
1939 282 0.00017033 30 0.000178154 TGTGTGAAGATCGGTTACTATGGCGGTGGCTGGACCTTTGAGTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(218.4) IGHD6-1900(47),IGHD3-1000(45),IGHD3-22*00(40) IGHJ4*00(349.7) IGHA100(118),IGHA200(118) 442|449|473|0|7|SC446T|41.0 24|39|63|18|33|SA27GSA30G|47.0;34|43|93|14|23||45.0;34|42|93|14|22||40.0 24|37|68|35|48|SC30G|101.0 ; TGTGTGAAGATCGGTTACTATGGCGGTGGCTGGACCTTTGAGTACTGG 45 CVKIGYYGGGWTFEYW :::::::::0:-4:7:18:-3:-3:33:35:-4:48:::
1965 279 0.000168518 30 0.000178154 TGTGCGAAACCTGGTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(884.8) nan IGHJ4*00(396) nan 442|451|473|0|9||90.0 nan 27|37|68|14|24||100.0 nan TGTGCGAAACCTGGTGACTACTGG 45 CAKPGDYW :::::::::0:-2:9:::::14:-7:24:::
1981 277 0.00016731 30 0.000178154 TGTGCGAGAACCTCCGACTACACGAACTATTCTCCTGTCGACTTTTACTTCGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-400(430),IGHV4-5500(430) IGHD4-1100(42),IGHD4-400(42) IGHJ2*00(381.9) IGHA100(65),IGHA200(65) 442|451|473|0|9||90.0;442|451|473|0|9||90.0 17|31|48|15|29|SG24CST25G|42.0;17|31|48|15|29|SG24CST25G|42.0 27|42|73|45|60||150.0 ; TGTGCGAGAACCTCCGACTACACGAACTATTCTCCTGTCGACTTTTACTTCGATCTCTGG 45 CARTSDYTNYSPVDFYFDLW :::::::::0:-2:9:15πŸ‘Ž-1:29:45:-7:60:::
1987 276 0.000166706 28 0.000166277 TGTCGCATTACTCAGCCTTCTCGCCATTTTTCCTTCTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-1100(133.9),IGHV3-7100(133.9) IGHD3-1000(31),IGHD3-2200(31),IGHD5-24*00(31) IGHJ4*00(288) IGHA100(114.4),IGHA200(114.4) 442|445|473|0|3||30.0;448|451|479|0|3||30.0 30|39|93|3|12|ST32C|31.0;30|39|93|3|12|ST32C|31.0;8|17|60|13|22|SA12T|31.0 21|37|68|32|48|SA23T|131.0 ; TGTCGCATTACTCAGCCTTCTCGCCATTTTTCCTTCTTTGACTACTGG 45 CRITQPSRHFSFFDYW :::::::::0:-8:3:3:1:-23:12:32πŸ‘Ž48:::
1999 275 0.000166102 30 0.000178154 TGTGTCGCACATTATTTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(726.7),IGHV3-700(726.7) nan IGHJ4*00(365.3) nan 442|446|473|0|4||40.0;442|446|473|0|4||40.0 nan 22|37|68|12|27|SC24TSA32C|92.0 nan TGTGTCGCACATTATTTTGACTCCTGG 45 CVAHYFDSW :::::::::0:-7:4:::::12:-2:27:::
2001 275 0.000166102 26 0.0001544 TGTGCGAGAGATCATCTGAGGGGCTGGAGCCTTGAGTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(783.7) IGHD6-19*00(31) IGHJ4*00(179.3) nan 442|455|473|0|13||130.0 30|39|63|18|27|ST32G|31.0 26|37|68|31|42|SC30G|81.0 nan TGTGCGAGAGATCATCTGAGGGGCTGGAGCCTTGAGTACTGG 45 CARDHLRGWSLEYW :::::::::0:2:13:18:-9:-3:27:31:-6:42:::
2015 274 0.000165498 27 0.000160338 TGTGCGAGAGAGAAGTACTATGGTTCGCAGACTTATTATATAGGGTTCGCCCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-46*00(756.7) IGHD3-10*00(69) IGHJ5*00(179.5) nan 442|453|473|0|11||110.0 35|60|93|15|40|SA46GSG47CSG48ASG51C|69.0 26|40|71|43|57|SA32C|111.0 nan TGTGCGAGAGAGAAGTACTATGGTTCGCAGACTTATTATATAGGGTTCGCCCCCTGG 45 CAREKYYGSQTYYIGFAPW :::::::::0:0:11:15:-4:-2:40:43:-6:57:::
2019 273 0.000164894 29 0.000172215 TGTGCGAGACATCCTCTGGGATATGCCACCTCGCCCGTCTATTACCACGCTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(446.3) IGHD2-1500(31),IGHD2-200(31),IGHD2-8*00(31) IGHJ6*00(464.3) IGHM*00(53.8) 445|457|476|0|12||120.0 29|38|93|15|24|SA31G|31.0;29|38|93|15|24|SA31G|31.0;29|38|93|15|24|SA31G|31.0 27|52|83|38|63|SC30TST34CSG38C|163.0 nan TGTGCGAGACATCCTCTGGGATATGCCACCTCGCCCGTCTATTACCACGCTATGGACGTCTGG 45 CARHPLGYATSPVYYHAMDVW :::::::::0:1:12:15:2:-24:24:38:-7:63:::
2037 271 0.000163686 25 0.000148461 TGTGCGAGAGATGATCGTCATGGGGTCTTGGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(372.1) IGHD4-1100(30),IGHD4-2300(30),IGHD4-4*00(30) IGHJ4*00(288.7) IGHA100(162.1),IGHA200(162.1) 442|454|473|0|12||120.0 12|18|48|16|22||30.0;15|21|57|16|22||30.0;12|18|48|16|22||30.0 24|37|68|26|39|ST27GST31C|72.0 ; TGTGCGAGAGATGATCGTCATGGGGTCTTGGACCACTGG 45 CARDDRHGVLDHW :::::::::0:1:12:16:4:-14:22:26:-4:39:::
2049 270 0.000163082 23 0.000136584 TGTGCGAAAGGGATCAGTTACTACCACGGCTTGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(601.8) IGHD7-27*00(25) IGHJ6*00(421.3) IGHM*00(147.3) 442|452|473|0|10||100.0 19|24|33|10|15||25.0 28|52|83|18|42|ST34CST39CSA40T|153.0 nan TGTGCGAAAGGGATCAGTTACTACCACGGCTTGGACGTCTGG 45 CAKGISYYHGLDVW :::::::::0:-1:10:10:-8:2:15:18:-8:42:::
2050 270 0.000163082 28 0.000166277 TGTACCACAGTTCGCTATGATAGAAGTGGTTACCCTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-15*00(545.7) IGHD3-22*00(76) IGHJ4*00(393.9) IGHG100(131.5),IGHG200(131.5),IGHG400(131.5),IGHGP00(131.5) 448|461|479|0|13|SA458T|101.0 37|55|93|14|32|ST46A|76.0 27|37|68|35|45||100.0 ;;; TGTACCACAGTTCGCTATGATAGAAGTGGTTACCCTGACTACTGG 45 CTTVRYDRSGYPDYW :::::::::0:2:13:14:-6:-7:32:35:-7:45:::
2078 267 0.00016127 24 0.000142523 TGTGTGAAAGGAGGGACGTGG NNNNNNNNNNNNNNNNNNNNN IGHV1-18*00(193.5) IGHD3-1000(25),IGHD6-600(25) IGHJ400(337.2),IGHJ500(337.2) IGHA1*00(207.5) 442|452|473|0|10|SC446TSG449A|42.0 46|51|93|11|16||25.0;0|5|54|13|18||25.0 34|37|68|18|21||30.0;37|40|71|18|21||30.0 nan TGTGTGAAAGGAGGGACGTGG 45 CVKGGTW :::::::::0:-1:10:11:-15:-11:16:18:-14:21:::
2079 267 0.00016127 26 0.0001544 TGTGCGAAAGATAAGAAGTACGGTGACTACTTTACGTCCGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(556.3) IGHD4-17*00(60) IGHJ4*00(357.3) IGHM*00(118.4) 442|454|473|0|12||120.0 20|32|48|18|30||60.0 28|37|68|39|48||90.0 nan TGTGCGAAAGATAAGAAGTACGGTGACTACTTTACGTCCGACTACTGG 45 CAKDKKYGDYFTSDYW :::::::::0:1:12:18:-4:0:30:39:-8:48:::
2081 267 0.00016127 26 0.0001544 TGTACAAGAGACATAGGTGGTCGCGCGGCCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(904) IGHD2-1500(31),IGHD2-2100(30),IGHD4-23*00(30) IGHJ4*00(222.1) nan 442|453|473|0|11|SG445A|81.0 44|53|93|15|24|SA50C|31.0;38|44|84|15|21||30.0;26|32|57|15|21||30.0 30|37|68|29|36||70.0 nan TGTACAAGAGACATAGGTGGTCGCGCGGCCTACTGG 45 CTRDIGGRAAYW :::::::::0:0:11:15:-13:-9:24:29:-10:36:::
2103 265 0.000160062 23 0.000136584 TGTGCGCACTCTGGGGACCCCTTTCACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-2*00(669.2) IGHD7-27*00(38) IGHJ4*00(373) nan 442|448|473|0|6||60.0 15|26|33|10|20|DT22|38.0 24|37|68|20|33|SG28C|101.0 nan TGTGCGCACTCTGGGGACCCCTTTCACTACTGG 45 CAHSGDPFHYW :::::::::0:-5:6:10:-4:4:20:20:-4:33:::
2124 263 0.000158854 29 0.000172215 TGTGCGAGAATAGCTGTGGCTGACAGGGGGTTCGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(940.5),IGHV3-700(940.5) IGHD6-19*00(51) IGHJ5*00(119.6) nan 442|451|473|0|9||90.0;442|451|473|0|9||90.0 25|38|63|9|22|SA30T|51.0 26|40|71|28|42|SC34TSC35T|82.0 nan TGTGCGAGAATAGCTGTGGCTGACAGGGGGTTCGACTTCTGG 45 CARIAVADRGFDFW :::::::::0:-2:9:9:-4:-4:22:28:-6:42:::
2134 262 0.00015825 27 0.000160338 TGTGTTAGAGATCTGGTTGGGGCGAAGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(864.2) IGHD3-16*00(30) IGHJ4*00(273.3) nan 442|456|473|0|14|SC446TSA447T|82.0 52|58|111|16|22||30.0 28|37|68|27|36||90.0 nan TGTGTTAGAGATCTGGTTGGGGCGAAGGACTACTGG 45 CVRDLVGAKDYW :::::::::0:3:14:16:-15:-16:22:27:-8:36:::
2136 262 0.00015825 29 0.000172215 TGTGCGAGAGTCATCGATTATTCCTTTGGTTCGGGGTCCTTTGACCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-11*00(271.8) IGHD3-10*00(48) IGHJ4*00(364.6) IGHA100(103.4),IGHA200(103.4) 442|452|473|0|10||100.0 32|50|93|18|36|SA36CSA39TSA46G|48.0 24|37|68|38|51|ST31CSA32T|72.0 ; TGTGCGAGAGTCATCGATTATTCCTTTGGTTCGGGGTCCTTTGACCTCTGG 45 CARVIDYSFGSGSFDLW :::::::::0:-1:10:18πŸ‘Ž-12:36:38:-4:51:::
2137 262 0.00015825 30 0.000178154 TGTGCGAGAGATCGCTCCCGCGAGTGGGAGTACTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-31*00(1004.5) IGHD1-2600(30),IGHD3-300(30) IGHJ4*00(289.7) nan 445|462|476|0|17|ST458G|141.0 25|31|60|22|28||30.0;46|52|93|21|27||30.0 17|37|68|28|48||200.0 nan TGTGCGAGAGATCGCTCCCGCGAGTGGGAGTACTACTTTGACTACTGG 45 CARDRSREWEYYFDYW :::::::::0:6:17:22:-5:-9:28:28:3:48:::
2152 261 0.000157646 27 0.000160338 TGCGCCAGATCCAACCCGATTCGCGATTCAAGAGGAAACTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-30-2*00(288.4) IGHD2-2100(29),IGHD6-1300(25),IGHD6-25*00(25) IGHJ3*00(253.4) IGHA100(109),IGHA200(109) 445|454|476|0|9|ST447C|61.0 44|55|84|17|29|I48CST50G|29.0;17|22|63|13|18||25.0;14|19|54|13|18||25.0 27|39|70|39|51||120.0 ; TGCGCCAGATCCAACCCGATTCGCGATTCAAGAGGAAACTTTGATATCTGG 45 CARSNPIRDSRGNFDIW :::::::::0:-2:9:17:-16:-1:29:39:-7:51:::
2166 260 0.000157042 21 0.000124708 TGTGCACGGACCCCCTCGACGTTTAGTGGGGGCGCTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-70*00(966.6) IGHD1-26*00(37) IGHJ4*00(196.1) nan 445|455|478|0|10||100.0 21|34|60|20|33|SA23TSA31G|37.0 27|37|68|35|45||100.0 nan TGTGCACGGACCCCCTCGACGTTTAGTGGGGGCGCTGACTACTGG 45 CARTPSTFSGGADYW :::::::::0:-3:10:20πŸ‘Ž-6:33:35:-7:45:::
2167 260 0.000157042 26 0.0001544 TGTGCAAAAGAAATAGGCAGTAGGGCAGCTGGTACTTCCTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-9*00(1017.9) IGHD2-200(60),IGHD6-1300(55) IGHJ4*00(172) nan 442|457|475|0|15|ST453A|121.0 6|18|93|24|36||60.0;31|42|63|24|35||55.0 24|37|68|38|51||130.0 nan TGTGCAAAAGAAATAGGCAGTAGGGCAGCTGGTACTTCCTTTGACTACTGG 45 CAKEIGSRAAGTSFDYW :::::::::0:2:15:24:25:-44:36:38:-4:51:::
2177 259 0.000156438 27 0.000160338 TGTGCACGGCTGAATTATTACTACTTCTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-70*00(555.3) nan IGHJ6*00(204.7) nan 445|454|478|0|9||90.0 nan 20|52|83|13|42|SC24TSA32TDG37DG38DT39|148.0 nan TGTGCACGGCTGAATTATTACTACTTCTACATGGACGTCTGG 45 CARLNYYYFYMDVW :::::::::0:-4:9:::::13:0:42:::
2191 258 0.000155834 26 0.0001544 TGTGCGACCCGAACGTGGATACAGCTATGGTTACCGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(936.6) IGHD5-5*00(110) IGHJ4*00(178.4) nan 442|449|473|0|7||70.0 18|40|60|12|34||110.0 28|37|68|36|45||90.0 nan TGTGCGACCCGAACGTGGATACAGCTATGGTTACCGGACTACTGG 45 CATRTWIQLWLPDYW :::::::::0:-4:7:12:2:0:34:36:-8:45:::
2192 258 0.000155834 24 0.000142523 TGTGCGAGGACCGTGGGAGATAATGATGCTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-5900(850.9),IGHV4-6100(850.9) IGHD1-26*00(35) IGHJ3*00(337.5) nan 439|447|470|0|8||80.0;445|453|476|0|8||80.0 26|33|60|12|19||35.0 16|39|70|19|42|SC18A|201.0 nan TGTGCGAGGACCGTGGGAGATAATGATGCTTTTGATATCTGG 45 CARTVGDNDAFDIW :::::::::0:-3:8:12:-6:-7:19:19:4:42:::
2193 258 0.000155834 23 0.000136584 TGTGCGAAAGCGACTATAGCAGCTCGACTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(821.8) IGHD6-6*00(66) IGHJ4*00(169.5) nan 442|452|473|0|10||100.0 17|33|54|10|26|SG20C|66.0 26|37|68|28|39|SA32C|81.0 nan TGTGCGAAAGCGACTATAGCAGCTCGACTTGACTCCTGG 45 CAKATIAARLDSW :::::::::0:-1:10:10:1:-3:26:28:-6:39:::
2236 254 0.000153418 22 0.000130646 TGTGCGAGAGGTTATGGTGGTTACGATTCGGCCTGGTTCGATCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-2*00(477.3) IGHD5-1200(52),IGHD5-1800(52) IGHJ5*00(258.6) nan 442|452|473|0|10||100.0 28|44|69|12|28|SA31GSC36T|52.0;28|44|69|12|28|SA31GSC36T|52.0 24|40|71|32|48|SC33T|131.0 nan TGTGCGAGAGGTTATGGTGGTTACGATTCGGCCTGGTTCGATCCCTGG 45 CARGYGGYDSAWFDPW :::::::::0:-1:10:12:-5:-2:28:32:-4:48:::
2244 253 0.000152814 22 0.000130646 TGTGCGTCCGAAGAGGAACGAGGGGTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-66*00(883.6) IGHD1-100(35),IGHD1-2000(35) IGHJ4*00(287.8) nan 439|445|470|0|6||60.0 26|33|51|14|21||35.0;26|33|51|14|21||35.0 26|37|68|25|36||110.0 nan TGTGCGTCCGAAGAGGAACGAGGGGTTGACTACTGG 45 CASEEERGVDYW :::::::::0:-5:6:14:-9:-1:21:25:-6:36:::
2245 253 0.000152814 23 0.000136584 TGTGCGAAAAGGGGCCCTACGGTGACTACGAAAGACTGGTACTTCGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(547.5) IGHD4-17*00(70) IGHJ2*00(459.4) IGHM*00(88.5) 442|451|473|0|9||90.0 19|33|48|16|30||70.0 22|42|73|34|54||200.0 nan TGTGCGAAAAGGGGCCCTACGGTGACTACGAAAGACTGGTACTTCGATCTCTGG 45 CAKRGPTVTTKDWYFDLW :::::::::0:-2:9:16:-3:1:30:34:-2:54:::
2246 253 0.000152814 24 0.000142523 TGTAGCCCACGGGGGAAGGGTAATGCCTTTAATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-1500(390.5),IGHV3-4900(390.5) IGHD3-1600(30),IGHD1-1400(26),IGHD5-12*00(26) IGHJ3*00(419.4) IGHG100(163.4),IGHG200(163.4),IGHG400(163.4),IGHGP00(163.4) 448|452|479|0|4||40.0;448|452|479|0|4||40.0 54|60|111|10|16||30.0;30|38|51|6|14|ST35G|26.0;19|27|69|6|14|ST24G|26.0 22|39|70|22|39|ST26CSG30A|112.0 ;;; TGTAGCCCACGGGGGAAGGGTAATGCCTTTAATATCTGG 45 CSPRGKGNAFNIW :::::::::0:-7:4:10:-17:-14:16:22:-2:39:::
2261 252 0.00015221 27 0.000160338 TGTGCGAGAGAGGAGGGCTATGAAAGTACTAGTTACAACTGGTTCGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-53*00(754.9) IGHD3-22*00(41) IGHJ5*00(162.1) nan 439|450|470|0|11||110.0 37|48|93|17|28|ST43A|41.0 19|40|71|33|54|SC34GSC35T|152.0 nan TGTGCGAGAGAGGAGGGCTATGAAAGTACTAGTTACAACTGGTTCGACGTCTGG 45 CAREEGYESTSYNWFDVW :::::::::0:0:11:17:-6:-14:28:33:1:54:::
2262 252 0.00015221 26 0.0001544 TGTGCGAAGCAAACGCCGAACGTCCAAAATCCCGTATACAGCAGTTATGTGGCCGACTGGTTCGACCCTTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-11*00(273.2) IGHD6-1300(43),IGHD6-2500(42) IGHJ5*00(408) nan 442|449|473|0|7||70.0 23|35|63|33|44|DG28|43.0;20|43|54|33|55|DG25SG30ASC32TSC35TSA38G|42.0 23|40|71|55|72|SC36T|141.0 nan TGTGCGAAGCAAACGCCGAACGTCCAAAATCCCGTATACAGCAGTTATGTGGCCGACTGGTTCGACCCTTGG 45 CAKQTPNVQNPVYSSYVADWFDPW :::::::::0:-4:7:33:-2:-7:44:55:-3:72:::
2284 250 0.000151002 25 0.000148461 TGTGCGAGACTGTCTCCCGCCGACTACGGTGATCACGTAGGATGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(277.6) IGHD4-17*00(67) IGHJ5*00(397.4) IGHG100(82.4),IGHG200(82.4),IGHG4*00(82.4) 445|455|476|0|10||100.0 17|36|48|21|40|SC28TST29C|67.0 25|40|71|42|57||150.0 ;; TGTGCGAGACTGTCTCCCGCCGACTACGGTGATCACGTAGGATGGTTCGACCCCTGG 45 CARLSPADYGDHVGWFDPW :::::::::0:-1:10:21πŸ‘Ž4:40:42:-5:57:::
2285 250 0.000151002 22 0.000130646 TGTGCGAAAATACTCAGTGGATACAACTATGGTGGTTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(785.4) IGHD5-5*00(71) IGHJ4*00(188.1) nan 442|451|473|0|9||90.0 20|37|60|16|33|SG29A|71.0 25|37|68|36|48||120.0 nan TGTGCGAAAATACTCAGTGGATACAACTATGGTGGTTTTGACTACTGG 45 CAKILSGYNYGGFDYW :::::::::0:-2:9:16:0:-3:33:36:-5:48:::
2294 249 0.000150398 30 0.000178154 TGTGCGAAACATTTTTGGAGTGGTTATCTATATGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(525.2) IGHD3-3*00(63) IGHJ4*00(378.1) IGHA100(146.8),IGHA200(146.8) 442|458|473|0|16|SG451CSC454T|102.0 45|60|93|16|32|I56C|63.0 27|37|68|32|42||100.0 ; TGTGCGAAACATTTTTGGAGTGGTTATCTATATGACTACTGG 45 CAKHFWSGYLYDYW :::::::::0:5:16:16:-14:-2:32:32:-7:42:::
2296 248 0.000149794 24 0.000142523 TGTTCGAGAGGCCGGTTTCGGCCGGGAGGTATGGGGAATGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-34*00(439.6) IGHD3-1000(31),IGHD3-1600(31),IGHD7-27*00(30) IGHJ4*00(262) IGHA100(125.8),IGHA200(125.8) 439|452|470|0|13|SG442T|101.0 47|56|93|23|32|ST52G|31.0;56|65|111|23|32|ST61G|31.0;16|22|33|31|37||30.0 27|37|68|38|48|SA32T|71.0 ; TGTTCGAGAGGCCGGTTTCGGCCGGGAGGTATGGGGAATGACTTCTGG 45 CSRGRFRPGGMGNDFW :::::::::0:2:13:23:-16:-6:32:38:-7:48:::
2306 248 0.000149794 25 0.000148461 TGTGGTAGAGTAGTTGGAACTACGTGGGATGACTACTATGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-72*00(381.5) IGHD1-7*00(55) IGHJ6*00(445.7) IGHM*00(80.3) 448|458|479|0|10|SC452G|71.0 25|36|51|14|25||55.0 29|52|83|31|54|SC36T|201.0 nan TGTGGTAGAGTAGTTGGAACTACGTGGGATGACTACTATGGTATGGACGTCTGG 45 CGRVVGTTWDDYYGMDVW :::::::::0:-1:10:14:-8:2:25:31:-9:54:::
2308 248 0.000149794 28 0.000166277 TGTACTAGAGTGTATTTACGTACGGTGACTACGTTCCTGGGAAGTAACTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-49*00(530.1) IGHD4-17*00(70) IGHJ4*00(475.8) IGHM*00(45) 448|458|479|0|10||100.0 20|34|48|20|34||70.0 20|37|68|46|63||170.0 nan TGTACTAGAGTGTATTTACGTACGGTGACTACGTTCCTGGGAAGTAACTACTTTGACTACTGG 45 CTRVYLRTVTTFLGSNYFDYW :::::::::0:-1:10:20:-4:2:34:46:0:63:::
2316 247 0.00014919 26 0.0001544 TGTGTGAAGATCGGTTACTATGGCGGTGGCTGGACCTTTGAGTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(193.6) IGHD6-1900(47),IGHD3-1000(45),IGHD3-22*00(40) IGHJ4*00(349.4) IGHG100(118),IGHG200(118),IGHG400(118),IGHGP00(118) 442|449|473|0|7|SC446T|41.0 24|39|63|18|33|SA27GSA30G|47.0;34|43|93|14|23||45.0;34|42|93|14|22||40.0 24|37|68|35|48|SC30G|101.0 ;;; TGTGTGAAGATCGGTTACTATGGCGGTGGCTGGACCTTTGAGTACTGG 45 CVKIGYYGGGWTFEYW :::::::::0:-4:7:18:-3:-3:33:35:-4:48:::
2319 247 0.00014919 25 0.000148461 TGTGCAAAAGATTACCTGAGCAGCTCGCCCTACTACTACGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-43*00(682.7) IGHD6-6*00(45) IGHJ6*00(293.2) nan 442|454|475|0|12||120.0 24|33|54|18|27||45.0 27|52|83|29|54||250.0 nan TGTGCAAAAGATTACCTGAGCAGCTCGCCCTACTACTACGGTATGGACGTCTGG 45 CAKDYLSSSPYYYGMDVW :::::::::0:-1:12:18:-6:-3:27:29:-7:54:::
2328 246 0.000148586 28 0.000166277 TGTGTCAGAAACAGGGGCTGGTTCACTTTTGATGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(638.9),IGHV3-700(638.9) IGHD6-1900(41),IGHD3-1000(35) IGHJ3*00(237.8) nan 442|446|473|0|4||40.0;442|446|473|0|4||40.0 29|40|63|11|22|ST32G|41.0;40|47|93|18|25||35.0 25|39|70|25|39|SA33G|111.0 nan TGTGTCAGAAACAGGGGCTGGTTCACTTTTGATGTCTGG 45 CVRNRGWFTFDVW :::::::::0:-7:4:11:-8:-2:22:25:-5:39:::
2330 246 0.000148586 27 0.000160338 TGTGCGAAAGGTGGTTACTGTGGTTCGGGGAGTTCTTATAGTGAACGCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(502.7) IGHD3-10*00(88) IGHJ4*00(370.6) IGHM*00(88.7) 442|452|473|0|10||100.0 34|60|93|14|40|SA39GSA46GSA54C|88.0 30|37|68|47|54||70.0 nan TGTGCGAAAGGTGGTTACTGTGGTTCGGGGAGTTCTTATAGTGAACGCTACTGG 45 CAKGGYCGSGSSYSERYW :::::::::0:-1:10:14:-3:-2:40:47:-10:54:::
2357 243 0.000146774 21 0.000124708 TGTGCGAGAGGCGGCTGGCAGAAGGATTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(504) IGHD6-1900(30),IGHD6-2500(30),IGHD6-13*00(26) IGHJ4*00(385) IGHM*00(152.1) 442|451|473|0|9||90.0 33|39|63|12|18||30.0;28|34|54|10|16||30.0;31|39|63|10|18|SA33G|26.0 25|37|68|27|39||120.0 nan TGTGCGAGAGGCGGCTGGCAGAAGGATTTTGACTACTGG 45 CARGGWQKDFDYW :::::::::0:-2:9:12:-12:-3:18:27:-5:39:::
2358 243 0.000146774 23 0.000136584 TGTGCGAGAGATCATGTGAGGGGCTGGAGCCTTGAGTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(891.1) IGHD6-19*00(31) IGHJ4*00(203.2) nan 442|455|473|0|13||130.0 30|39|63|18|27|ST32G|31.0 26|37|68|31|42|SC30G|81.0 nan TGTGCGAGAGATCATGTGAGGGGCTGGAGCCTTGAGTACTGG 45 CARDHVRGWSLEYW :::::::::0:2:13:18:-9:-3:27:31:-6:42:::
2378 241 0.000145566 20 0.000118769 TGTGCGAGACTACGCGTGTCCGAACCGCAGCCCTCCCGCTACTACTTCCACGGAATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(513.8) IGHD6-600(26),IGHD6-1300(25),IGHD6-25*00(25) IGHJ6*00(382.8) IGHA100(40),IGHA200(40) 442|452|473|0|10||100.0 32|40|54|17|25|SG37A|26.0;28|33|63|26|31||25.0;25|30|54|26|31||25.0 24|52|83|38|66|SA32TST34CST39A|193.0 ; TGTGCGAGACTACGCGTGTCCGAACCGCAGCCCTCCCGCTACTACTTCCACGGAATGGACGTCTGG 45 CARLRVSEPQPSRYYFHGMDVW :::::::::0:-1:10:17:-14:4:25:38:-4:66:::
2406 239 0.000144358 24 0.000142523 TGTGCGAGACTAAGTCGGGGGGACGGTGGGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(989.9) IGHD4-2300(35),IGHD3-1600(30),IGHD4-17*00(30) IGHJ4*00(247.2) nan 442|452|473|0|10||100.0 24|31|57|22|29||35.0;54|60|111|17|23||30.0;21|27|48|22|28||30.0 28|37|68|30|39||90.0 nan TGTGCGAGACTAAGTCGGGGGGACGGTGGGGACTACTGG 45 CARLSRGDGGDYW :::::::::0:-1:10:22:-5:-7:29:30:-8:39:::
2407 239 0.000144358 21 0.000124708 TGTGCGAGAGATCATATAAAGGGCTGGAGCCTTGAGTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(296.5) IGHD6-19*00(30) IGHJ4*00(349.5) IGHG100(147.6),IGHG200(147.6),IGHG400(147.6),IGHGP00(147.6) 442|455|473|0|13||130.0 33|39|63|21|27||30.0 26|37|68|31|42|SC30G|81.0 ;;; TGTGCGAGAGATCATATAAAGGGCTGGAGCCTTGAGTACTGG 45 CARDHIKGWSLEYW :::::::::0:2:13:21:-12:-3:27:31:-6:42:::
2408 239 0.000144358 27 0.000160338 TGTGCGAAAGGGATCACTTACTACTACGATATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(479.2) IGHD2-2100(25),IGHD7-2700(25) IGHJ6*00(514.2) IGHG100(147.8),IGHG200(147.8),IGHG4*00(147.8) 442|452|473|0|10||100.0 9|14|84|12|17||25.0;19|24|33|10|15||25.0 28|52|83|18|42|SG38A|211.0 ;; TGTGCGAAAGGGATCACTTACTACTACGATATGGACGTCTGG 45 CAKGITYYYDMDVW :::::::::0:-1:10:12:19:-42:17:18:-8:42:::
2409 239 0.000144358 25 0.000148461 TGTGCGAAAGGGATCAGTTACTACTACGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(559.5) IGHD7-27*00(25) IGHJ6*00(523.1) IGHD*00(147.8) 442|452|473|0|10||100.0 19|24|33|10|15||25.0 28|52|83|18|42||240.0 nan TGTGCGAAAGGGATCAGTTACTACTACGGTATGGACGTCTGG 45 CAKGISYYYGMDVW :::::::::0:-1:10:10:-8:2:15:18:-8:42:::
2422 238 0.000143754 25 0.000148461 TGTGCGAGACATCATGAGTTGGTTCGGGGTATTATTGGTTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(447.4) IGHD3-10*00(44) IGHJ5*00(409.2) IGHA100(97.2),IGHA200(97.2) 445|457|476|0|12||120.0 40|59|93|19|35|DA46DA50DT52|44.0 25|40|71|39|54||150.0 ; TGTGCGAGACATCATGAGTTGGTTCGGGGTATTATTGGTTGGTTCGACCCCTGG 45 CARHHELVRGIIGWFDPW :::::::::0:1:12:19:-9:-3:35:39:-5:54:::
2435 237 0.00014315 25 0.000148461 TGTGTGAGAGATGCGGCCACTACTCCCGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-48*00(799) IGHD3-2200(40),IGHD2-1500(35),IGHD5-12*00(35) IGHJ6*00(287.8) nan 442|454|473|0|12|SC446T|91.0 10|18|93|16|24||40.0;16|23|93|16|23||35.0;9|16|69|15|22||35.0 36|52|83|26|42||160.0 nan TGTGTGAGAGATGCGGCCACTACTCCCGGTATGGACGTCTGG 45 CVRDAATTPGMDVW :::::::::0:1:12:16:21:-44:24:26:-16:42:::
2436 237 0.00014315 25 0.000148461 TGTGCTAGAGGCGACCAATTTTGCACGAGGACCACCTGCTATGCCTTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-1100(155.5),IGHV3-4900(153.8) IGHD2-2*00(57) IGHJ4*00(378.9) IGHG3*00(74.5) 442|452|473|0|10|SG447T|71.0;448|458|479|0|10|SA451G|71.0 44|61|93|27|44|ST46GSG51C|57.0 24|37|68|44|57|SA32C|101.0 nan TGTGCTAGAGGCGACCAATTTTGCACGAGGACCACCTGCTATGCCTTTGACTCCTGG 45 CARGDQFCTRTTCYAFDSW :::::::::0:-1:10:27:-13:-1:44:44:-4:57:::
2448 236 0.000142546 21 0.000124708 TGTGCCTTAGTGGTGGTAGCTGCTAAGTCACGATGGTACTTCGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-26*00(326.2) IGHD2-15*00(90) IGHJ2*00(462.1) IGHG100(113.6),IGHG200(113.6),IGHG400(113.6),IGHGP00(113.6) 445|450|478|0|5||50.0 40|58|93|7|25||90.0 24|42|73|33|51||180.0 ;;; TGTGCCTTAGTGGTGGTAGCTGCTAAGTCACGATGGTACTTCGATCTCTGG 45 CALVVVAAKSRWYFDLW :::::::::0:-8:5:7:-9:-4:25:33:-4:51:::
2463 235 0.000141942 19 0.000112831 TGTGTAAGAGATCTCGTCGGGTCGAGGGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(580.6) IGHD6-600(27),IGHD6-1300(25),IGHD6-25*00(25) IGHJ4*00(263.3) IGHA100(175.4),IGHA200(175.4) 442|457|473|0|15|SC446T|121.0 32|43|54|15|26|SC35GSA38T|27.0;20|25|63|17|22||25.0;17|22|54|17|22||25.0 28|37|68|27|36|ST31C|61.0 ; TGTGTAAGAGATCTCGTCGGGTCGAGGGACCACTGG 45 CVRDLVGSRDHW :::::::::0:4:15:15:-14:7:26:27:-8:36:::
2467 235 0.000141942 25 0.000148461 TGTGCGAGAAGTGCCGGGAACTTCGGTGGGGGTGAGACCGACTTCTACTTCTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(384.9) IGHD2-2100(36),IGHD4-2300(36),IGHD1-7*00(31) IGHJ6*00(337.6) nan 442|451|473|0|9||90.0 36|46|84|25|35|ST40G|36.0;21|31|57|19|29|SA24T|36.0;26|35|51|16|25|SA32T|31.0 40|52|83|54|66||120.0 nan TGTGCGAGAAGTGCCGGGAACTTCGGTGGGGGTGAGACCGACTTCTACTTCTACATGGACGTCTGG 45 CARSAGNFGGGETDFYFYMDVW :::::::::0:-2:9:25:-8:-10:35:54:-20:66:::
2468 235 0.000141942 25 0.000148461 TGTGCGAAACATTTTTGGAGTGGTTATCTATATGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(820.4) IGHD3-3*00(63) IGHJ4*00(219.8) nan 442|458|473|0|16|SG451CSC454T|102.0 45|60|93|16|32|I56C|63.0 27|37|68|32|42||100.0 nan TGTGCGAAACATTTTTGGAGTGGTTATCTATATGACTACTGG 45 CAKHFWSGYLYDYW :::::::::0:5:16:16:-14:-2:32:32:-7:42:::
2469 235 0.000141942 20 0.000118769 TGTGCGAAAGATATTCTCTGGTGGTCCTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(544) IGHD2-800(40),IGHD2-1500(35),IGHD2-21*00(35) IGHJ4*00(324.3) IGHG100(163.5),IGHG200(163.5),IGHG400(163.5),IGHGP00(163.5) 442|457|473|0|15|SC454A|121.0 42|50|93|17|25||40.0;43|50|93|18|25||35.0;37|44|84|18|25||35.0 24|37|68|26|39||130.0 ;;; TGTGCGAAAGATATTCTCTGGTGGTCCTTTGACTACTGG 45 CAKDILWWSFDYW :::::::::0:4:15:17:-11:-12:25:26:-4:39:::
2480 234 0.000141338 23 0.000136584 TGTGCGAGGAGCGTCGCCAAGGATCATTGGAGTGGTTACTATGGTATATCGGGTTACTACGCCATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-400(383.7),IGHV4-5500(383.7) IGHD3-3*00(66) IGHJ6*00(403.8) nan 442|450|473|0|8||80.0;442|450|473|0|8||80.0 43|59|93|26|42|ST55C|66.0 31|52|83|54|75|SG38CST39C|152.0 nan TGTGCGAGGAGCGTCGCCAAGGATCATTGGAGTGGTTACTATGGTATATCGGGTTACTACGCCATGGACGTCTGG 45 CARSVAKDHWSGYYGISGYYAMDVW :::::::::0:-3:8:26:-12:-3:42:54:-11:75:::
2481 234 0.000141338 22 0.000130646 TGTGCGAGAGGCCGATTTGGGGATAGTAGAAATTCCTTCAACTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-34*00(669.6) IGHD3-1600(40),IGHD3-2200(40),IGHD7-27*00(35) IGHJ5*00(189.4) nan 439|452|470|0|13||130.0 50|58|111|14|22||40.0;41|49|93|21|29||40.0;16|23|33|17|24||35.0 21|40|71|38|57||190.0 nan TGTGCGAGAGGCCGATTTGGGGATAGTAGAAATTCCTTCAACTGGTTCGACCCCTGG 45 CARGRFGDSRNSFNWFDPW :::::::::0:2:13:14:-13:-16:22:38πŸ‘Ž57:::
2482 234 0.000141338 21 0.000124708 TGTGCGAAAGCTGTGGCTCTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-11*00(606.3) IGHD5-1200(30),IGHD5-1800(30),IGHD6-19*00(30) IGHJ4*00(316.2) nan 442|452|473|0|10|SG449A|71.0 32|38|69|12|18||30.0;32|38|69|12|18||30.0;31|37|63|12|18||30.0 26|37|68|19|30|SA32C|81.0 nan TGTGCGAAAGCTGTGGCTCTTGACTCCTGG 45 CAKAVALDSW :::::::::0:-1:10:12:-9:-8:18:19:-6:30:::
2504 232 0.00014013 23 0.000136584 TGTGCCAGAGTGCCCTTGGGGGACGACTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-30-2*00(499.8) IGHD3-16*00(40) IGHJ4*00(445.7) IGHM*00(147.2) 445|455|476|0|10||100.0 52|60|111|15|23||40.0 20|37|68|25|42||170.0 nan TGTGCCAGAGTGCCCTTGGGGGACGACTACTTTGACTACTGG 45 CARVPLGDDYFDYW :::::::::0:-1:10:15:-15:-14:23:25:0:42:::
2505 232 0.00014013 25 0.000148461 TGTGCGAGAGAGAAGGCAGCATCTGATATTTGGGGGTACTACGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-11*00(267.4) IGHD3-16*00(45) IGHJ5*00(288.5) IGHA100(103.4),IGHA200(103.4) 442|453|473|0|11||110.0 50|59|111|27|36||45.0 30|40|71|41|51|SC34T|71.0 ; TGTGCGAGAGAGAAGGCAGCATCTGATATTTGGGGGTACTACGACTCCTGG 45 CAREKAASDIWGYYDSW :::::::::0:0:11:27:-13:-15:36:41:-10:51:::
2506 232 0.00014013 20 0.000118769 TGTGCACGGGATAGTCGGAATCCGTGGGGTGCTTTTGATTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-70*00(355.9) IGHD1-1400(34),IGHD1-2600(31),IGHD3-22*00(30) IGHJ3*00(404.7) IGHA100(143.2),IGHA200(143.2) 445|454|478|0|9||90.0 25|38|51|15|27|SC30TDA32|34.0;23|32|60|10|19|SG28C|31.0;41|47|93|9|15||30.0 23|39|70|29|45|SA33T|131.0 ; TGTGCACGGGATAGTCGGAATCCGTGGGGTGCTTTTGATTTCTGG 45 CARDSRNPWGAFDFW :::::::::0:-4:9:15:-8:4:27:29:-3:45:::
2522 231 0.000139526 24 0.000142523 TGTGCGAGAATGTGGGAGTGGTTGCCCCGGGTTTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-5900(699.8),IGHV4-6100(699.8) IGHD3-3*00(45) IGHJ1*00(230.1) nan 439|448|470|0|9||90.0;445|454|476|0|9||90.0 45|54|93|14|23||45.0 38|41|72|33|36||30.0 nan TGTGCGAGAATGTGGGAGTGGTTGCCCCGGGTTTGG 45 CARMWEWLPRVW :::::::::0:-2:9:14:-14:-8:23:33:-18:36:::
2537 230 0.000138922 26 0.0001544 TGTGTAAGAGATCTCGTCGGGTCGAGGGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(969.3) IGHD6-600(27),IGHD6-1300(25),IGHD6-25*00(25) IGHJ400(119),IGHJ500(115.7) nan 442|457|473|0|15|SC446T|121.0 32|43|54|15|26|SC35GSA38T|27.0;20|25|63|17|22||25.0;17|22|54|17|22||25.0 28|37|68|27|36|ST31C|61.0;31|40|71|27|36|SC35A|61.0 nan TGTGTAAGAGATCTCGTCGGGTCGAGGGACCACTGG 45 CVRDLVGSRDHW :::::::::0:4:15:15:-14:7:26:27:-8:36:::
2538 230 0.000138922 24 0.000142523 TGTGTAAGAGATCTGGTCGGGCCGAAGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(849.7) nan IGHJ4*00(266.4) nan 442|456|473|0|14|SC446T|111.0 nan 28|37|68|27|36||90.0 nan TGTGTAAGAGATCTGGTCGGGCCGAAGGACTACTGG 45 CVRDLVGPKDYW :::::::::0:3:14:::::27:-8:36:::
2546 230 0.000138922 25 0.000148461 TGTGCGACTCACCCCTGGGTCCTCCCCACGGGATGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-30*00(935.3) IGHD3-1600(30),IGHD7-2700(30),IGHD5-12*00(28) IGHJ4*00(209.5) nan 442|449|473|0|7||70.0 13|19|111|21|27||30.0;0|6|33|22|28||30.0;19|28|69|25|33|DT24|28.0 34|37|68|33|36||30.0 nan TGTGCGACTCACCCCTGGGTCCTCCCCACGGGATGG 45 CATHPWVLPTGW :::::::::0:-4:7:21:24:-55:27:33:-14:36:::
2547 230 0.000138922 24 0.000142523 TGTGCGAAAGGTGGTTACTGTGGTTCGGGGAGTTCTTATAATGAACGCTATTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(455.1) IGHD3-10*00(93) IGHJ4*00(345.2) IGHM*00(88.9) 442|452|473|0|10||100.0 34|61|93|14|41|SA39GSA46GSA54C|93.0 30|37|68|47|54|SC33T|41.0 nan TGTGCGAAAGGTGGTTACTGTGGTTCGGGGAGTTCTTATAATGAACGCTATTGG 45 CAKGGYCGSGSSYNERYW :::::::::0:-1:10:14:-3:-1:41:47:-10:54:::
2560 229 0.000138318 23 0.000136584 TGTGGTAGAGTAGTTGGAACTACGTGGGATGACTACTATGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-72*00(903.4) IGHD1-7*00(55) IGHJ6*00(219.7) nan 448|458|479|0|10|SC452G|71.0 25|36|51|14|25||55.0 29|52|83|31|54|SC36T|201.0 nan TGTGGTAGAGTAGTTGGAACTACGTGGGATGACTACTATGGTATGGACGTCTGG 45 CGRVVGTTWDDYYGMDVW :::::::::0:-1:10:14:-8:2:25:31:-9:54:::
2567 228 0.000137714 26 0.0001544 TGTGCGAGACGGCATTATTATGATATTAGTGGTTCCGCTTTCCTTCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(513.1) IGHD3-22*00(77) IGHJ1*00(367) IGHG100(110.8),IGHG200(110.8),IGHG400(110.8),IGHGP00(110.8) 442|452|473|0|10||100.0 33|54|93|13|34|SC37TSG45T|77.0 29|41|72|39|51|SA33TSG34T|62.0 ;;; TGTGCGAGACGGCATTATTATGATATTAGTGGTTCCGCTTTCCTTCACTGG 45 CARRHYYDISGSAFLHW :::::::::0:-1:10:13:-2:-8:34:39:-9:51:::
2580 227 0.00013711 23 0.000136584 TGTGCGAGACTTAATGGATACAACTATGGTTTCACCTATGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(355.7) IGHD5-5*00(71) IGHJ4*00(374.5) IGHM*00(119.8) 445|455|476|0|10||100.0 21|38|60|14|31|SG29A|71.0 24|37|68|35|48|ST26A|101.0 nan TGTGCGAGACTTAATGGATACAACTATGGTTTCACCTATGACTACTGG 45 CARLNGYNYGFTYDYW :::::::::0:-1:10:14πŸ‘Ž-2:31:35:-4:48:::
2581 227 0.00013711 23 0.000136584 TGTGCGAAAGTCCGGGCGCACGATTTTTGGCTTGGTTTTTATGGGACTTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(442.8) IGHD3-3*00(73) IGHJ6*00(338.3) IGHG100(45),IGHG200(45),IGHG400(45),IGHGP00(45) 442|452|473|0|10||100.0 36|59|93|19|42|SA47CSG48TSA54T|73.0 40|52|83|51|63||120.0 ;;; TGTGCGAAAGTCCGGGCGCACGATTTTTGGCTTGGTTTTTATGGGACTTACATGGACGTCTGG 45 CAKVRAHDFWLGFYGTYMDVW :::::::::0:-1:10:19:-5:-3:42:51:-20:63:::
2583 227 0.00013711 20 0.000118769 TGTGCAAGAGAAGCAGGGTACACCCCGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV6-1*00(480.9) IGHD1-100(30),IGHD2-800(30),IGHD6-25*00(26) IGHJ4*00(396.9) IGHM*00(184.5) 454|465|485|0|11||110.0 17|23|51|16|22||30.0;9|15|93|18|24||30.0;24|36|54|11|21|DC29DC32|26.0 28|37|68|27|36||90.0 nan TGTGCAAGAGAAGCAGGGTACACCCCGGACTACTGG 45 CAREAGYTPDYW :::::::::0:0:11:16:0:-11:22:27:-8:36:::
2605 226 0.000136506 21 0.000124708 TGTGCGCGAGTCCGGCATCCGAGTGACTTCGACTACTATGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-34*00(380.7) IGHD4-17*00(31) IGHJ4*00(330.2) IGHG100(126.3),IGHG200(126.3),IGHG400(126.3),IGHGP00(126.3) 439|452|470|0|13|SA445CSG449T|72.0 24|33|48|22|31|SA30T|31.0 20|37|68|31|48|ST26ASA32C|112.0 ;;; TGTGCGCGAGTCCGGCATCCGAGTGACTTCGACTACTATGACTCCTGG 45 CARVRHPSDFDYYDSW :::::::::0:2:13:22:-8:1:31:31:0:48:::
2606 226 0.000136506 26 0.0001544 TGTGCGCGAATGAACTGGAGGGACTCCGGGATGATTGTCTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-59*00(743.1) IGHD1-700(35),IGHD2-1500(35),IGHD4-23*00(35) IGHJ5*00(187.1) nan 439|448|470|0|9|SA445C|61.0 22|29|51|12|19||35.0;57|64|93|22|29||35.0;33|40|57|22|29||35.0 24|40|71|38|54||160.0 nan TGTGCGCGAATGAACTGGAGGGACTCCGGGATGATTGTCTGGTTCGACCCCTGG 45 CARMNWRDSGMIVWFDPW :::::::::0:-2:9:12:-5:-5:19:38:-4:54:::
2607 226 0.000136506 22 0.000130646 TGTGCGGCGAGTTTAAGAACTCTCGGAGCTTATGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-1100(166.1),IGHV3-2300(166.1) IGHD3-1000(34),IGHD4-2300(33) IGHJ3*00(400.1) IGHG100(149.4),IGHG200(149.4),IGHG400(149.4),IGHGP00(149.4) 442|448|473|0|6||60.0;442|448|473|0|6||60.0 0|13|93|10|22|DA3ST7G|34.0;32|41|57|17|27|I37T|33.0 24|39|70|27|42|ST28A|121.0 ;;; TGTGCGGCGAGTTTAAGAACTCTCGGAGCTTATGATATCTGG 45 CAASLRTLGAYDIW :::::::::0:-5:6:10:31:-49:22:27:-4:42:::
2608 226 0.000136506 22 0.000130646 TGTGCGAGAATAGCTGTGGCTGACAGGGGGTTCGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(352.1) IGHD6-19*00(51) IGHJ4*00(384.9) IGHG100(148.7),IGHG200(148.7),IGHG400(148.7),IGHGP00(148.7) 442|451|473|0|9||90.0 25|38|63|9|22|SA30T|51.0 25|37|68|30|42|ST27C|91.0 ;;; TGTGCGAGAATAGCTGTGGCTGACAGGGGGTTCGACTACTGG 45 CARIAVADRGFDYW :::::::::0:-2:9:9:-4:-4:22:30:-5:42:::
2614 226 0.000136506 29 0.000172215 TGCGCCAGAGCGTGGGACAGGAGTGGGACGGCCTTCCTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-30-2*00(358.8) IGHD1-2600(35),IGHD3-300(35) IGHJ4*00(291.6) IGHA100(125.1),IGHA200(125.1) 445|455|476|0|10|ST447C|71.0 25|32|60|21|28||35.0;45|52|93|19|26||35.0 26|37|68|37|48|SA32C|81.0 ; TGCGCCAGAGCGTGGGACAGGAGTGGGACGGCCTTCCTTGACTCCTGG 45 CARAWDRSGTAFLDSW :::::::::0:-1:10:21:-5:-8:28:37:-6:48:::
2628 225 0.000135902 19 0.000112831 TGTGTGAGACATACCCGGATACCCTTTGATCGATGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(625.6) IGHD6-1300(31),IGHD6-1900(31),IGHD6-25*00(31) IGHJ400(323.2),IGHJ500(323.2) IGHA100(129.7),IGHA200(129.7) 442|454|473|0|12|SC446T|91.0 17|26|63|12|21|SG23A|31.0;17|26|63|12|21|SG23A|31.0;14|23|54|12|21|SG20A|31.0 34|37|68|33|36||30.0;37|40|71|33|36||30.0 ; TGTGTGAGACATACCCGGATACCCTTTGATCGATGG 45 CVRHTRIPFDRW :::::::::0:1:12:12:4:-16:21:33:-14:36:::
2629 225 0.000135902 24 0.000142523 TGTGTGAGAGATATCTTCAACTGGGACCGGGAAAACTTCGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-11*00(565.4) IGHD1-100(36),IGHD7-2700(35),IGHD1-7*00(31) IGHJ2*00(179.8) nan 442|458|473|0|16|SC446TSC454A|102.0 21|31|51|17|27|SA28G|36.0;13|20|33|18|25||35.0;22|31|51|18|27|SA28G|31.0 28|42|73|34|48||140.0 nan TGTGTGAGAGATATCTTCAACTGGGACCGGGAAAACTTCGATCTCTGG 45 CVRDIFNWDRENFDLW :::::::::0:5:16:17:-4:-3:27:34:-8:48:::
2633 225 0.000135902 23 0.000136584 TGTGCGCGACAAGGAGGCATTGTGGTAGTTGGCACATATTACTATTATTATAATCTGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(406) IGHD3-2200(47),IGHD3-1000(46),IGHD3-16*00(45) IGHJ6*00(358.7) IGHA100(40),IGHA200(40) 442|453|473|0|11|SA448C|81.0 29|44|93|33|48|SG31ASG41T|47.0;29|41|93|33|45|SG31A|46.0;29|47|111|34|51|SA33TDG37SG44T|45.0 41|52|83|55|66||110.0 ; TGTGCGCGACAAGGAGGCATTGTGGTAGTTGGCACATATTACTATTATTATAATCTGGACGTCTGG 45 CARQGGIVVVGTYYYYYNLDVW :::::::::0:0:11:33:2:-18:48:55:-21:66:::
2634 225 0.000135902 23 0.000136584 TGTGCGACTCACCCCTGGGTCCTCCCCACGGGATGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-30*00(408.7) IGHD3-1600(30),IGHD7-2700(30),IGHD5-12*00(28) IGHJ4*00(335.2) IGHG3*00(177.8) 442|449|473|0|7||70.0 13|19|111|21|27||30.0;0|6|33|22|28||30.0;19|28|69|25|33|DT24|28.0 34|37|68|33|36||30.0 nan TGTGCGACTCACCCCTGGGTCCTCCCCACGGGATGG 45 CATHPWVLPTGW :::::::::0:-4:7:21:24:-55:27:33:-14:36:::
2635 225 0.000135902 23 0.000136584 TGTGCGAGGGCGCTTAGTGGGAAAACACTCACTTTTCACCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-5900(352.9),IGHV4-6100(352.9) IGHD1-26*00(40) IGHJ5*00(323) IGHM*00(121.4) 439|447|470|0|8||80.0;445|453|476|0|8||80.0 24|32|60|14|22||40.0 32|40|71|37|45|SC35T|51.0 nan TGTGCGAGGGCGCTTAGTGGGAAAACACTCACTTTTCACCTCTGG 45 CARALSGKTLTFHLW :::::::::0:-3:8:14:-4:-8:22:37:-12:45:::
2636 225 0.000135902 21 0.000124708 TGTGCGAGATTCGTCGATGGGGACCCTGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-5500(256.1),IGHV4-400(250.1) IGHD7-27*00(33) IGHJ4*00(345.7) IGHA100(174),IGHA200(174) 442|452|473|0|10||100.0;442|451|473|0|9||90.0 16|26|33|17|26|DT22|33.0 27|37|68|26|36|SA32T|71.0 ; TGTGCGAGATTCGTCGATGGGGACCCTGACTTCTGG 45 CARFVDGDPDFW :::::::::0:-1:10:17:-5:4:26:26:-7:36:::
2649 224 0.000135298 23 0.000136584 TGTGCGAGAGATCGTCGTAACGCTGAGTGCGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-48*00(909.5) IGHD3-300(30),IGHD3-900(30),IGHD5-5*00(30) IGHJ5*00(229.6) nan 442|455|473|0|13||130.0 22|28|93|14|20||30.0;22|28|93|14|20||30.0;39|45|60|15|21||30.0 27|40|71|26|39|ST29GSC34T|72.0 nan TGTGCGAGAGATCGTCGTAACGCTGAGTGCGACTCCTGG 45 CARDRRNAECDSW :::::::::0:2:13:14:9:-34:20:26:-7:39:::
2663 223 0.000134694 24 0.000142523 TGTGCGAGGTGGGGTAAAGCATCAGGTGGTGTGTTTTCTATTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(309.8) IGHD6-13*00(53) IGHJ4*00(372.7) IGHG100(104),IGHG200(104),IGHG400(104),IGHGP00(104) 442|450|473|0|8||80.0 21|40|63|11|30|ST26ASG31TSC35G|53.0 26|37|68|40|51||110.0 ;;; TGTGCGAGGTGGGGTAAAGCATCAGGTGGTGTGTTTTCTATTGACTACTGG 45 CARWGKASGGVFSIDYW :::::::::0:-3:8:11:0:-2:30:40:-6:51:::
2664 223 0.000134694 17 0.000100954 TGTGCGAGAACTCTTCCAACCGACTGGTACTTCGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-33*00(775.8) IGHD1-1400(25),IGHD1-700(25),IGHD3-3*00(25) IGHJ2*00(319.6) nan 442|451|473|0|9||90.0 22|27|51|17|22||25.0;4|9|51|13|18||25.0;14|19|93|14|19||25.0 22|42|73|22|42||200.0 nan TGTGCGAGAACTCTTCCAACCGACTGGTACTTCGATCTCTGG 45 CARTLPTDWYFDLW :::::::::0:-2:9:17:-5:-7:22:22:-2:42:::
2665 223 0.000134694 21 0.000124708 TGTGCAAGCGACTTTCCCTTCGATTCGGGGAGTTATAGTTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(934.7) IGHD3-1600(52),IGHD3-1000(51) IGHJ4*00(162.1) nan 442|453|473|0|11|SA450C|81.0 52|68|111|23|39|SG54CSC65A|52.0;43|56|93|23|36|SA46G|51.0 25|37|68|39|51||120.0 nan TGTGCAAGCGACTTTCCCTTCGATTCGGGGAGTTATAGTTTTGACTACTGG 45 CASDFPFDSGSYSFDYW :::::::::0:0:11:23:-15:-6:39:39:-5:51:::
2666 223 0.000134694 22 0.000130646 TGTACGAGGGCTATGGGGGCACATAATGTGTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV6-1*00(335.8) IGHD5-500(35),IGHD2-200(32),IGHD2-21*00(31) IGHJ400(269.3),IGHJ500(269.3) IGHG200(201.6),IGHG400(201.6) 454|457|485|0|3||30.0 29|36|60|9|16||35.0;54|66|93|9|21|SC60GSC61G|32.0;30|39|84|21|30|ST34A|31.0 34|37|68|30|33||30.0;37|40|71|30|33||30.0 ; TGTACGAGGGCTATGGGGGCACATAATGTGTGG 45 CTRAMGAHNVW :::::::::0:-8:3:9:-9:-4:16:30:-14:33:::
2679 222 0.00013409 25 0.000148461 TGTGCCACAGGTGTCAGGTGGAAACGATTCTGGACACATTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-64*00(111.5) IGHD5-1200(32),IGHD5-1800(32),IGHD4-23*00(31) IGHJ4*00(308.1) IGHA100(147.9),IGHA200(147.9) 442|447|473|0|5||50.0 32|44|69|17|29|SC36AST37A|32.0;32|44|69|17|29|SC36AST37A|32.0;26|35|57|16|25|ST31A|31.0 34|37|68|39|42||30.0 ; TGTGCCACAGGTGTCAGGTGGAAACGATTCTGGACACATTGG 45 CATGVRWKRFWTHW :::::::::0:-6:5:17:-9:-2:29:39:-14:42:::
2682 222 0.00013409 24 0.000142523 TGTGCGAAAGGGATCAGTTACTATAACGCTGTGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(429.3) IGHD7-27*00(25) IGHJ6*00(383) IGHM*00(143.5) 442|452|473|0|10||100.0 19|24|33|10|15||25.0 28|52|83|18|42|SC33TST34ASG38CSA40G|124.0 nan TGTGCGAAAGGGATCAGTTACTATAACGCTGTGGACGTCTGG 45 CAKGISYYNAVDVW :::::::::0:-1:10:10:-8:2:15:18:-8:42:::
2694 221 0.000133486 25 0.000148461 TGTGTGAAAGGGGGGGGGTTTTTTGGCGTTTCTATCGGCGCTGACTACTACTACTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(443.4) IGHD3-300(36),IGHD3-1600(31) IGHJ6*00(435.8) nan 442|452|473|0|10|SC446T|71.0 40|50|93|19|29|SA47C|36.0;54|63|111|11|20|SA59G|31.0 23|52|83|43|69|DG37DG38DT39|176.0 nan TGTGTGAAAGGGGGGGGGTTTTTTGGCGTTTCTATCGGCGCTGACTACTACTACTACATGGACGTCTGG 45 CVKGGGFFGVSIGADYYYYMDVW :::::::::0:-1:10:19:-9:-12:29:43:-3:69:::
2708 220 0.000132882 21 0.000124708 TGTACCTCAGATTATACTAGTGGTCTAGCCCATGTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-15*00(818.4) IGHD3-2200(41),IGHD2-800(37),IGHD5-12*00(36) IGHJ4*00(230.7) nan 448|460|479|0|12|SA454T|91.0 42|53|93|13|24|SG45C|41.0;40|53|93|14|27|SG44ASG50C|37.0;27|39|69|13|27|I30CI36T|36.0 26|37|68|34|45||110.0 nan TGTACCTCAGATTATACTAGTGGTCTAGCCCATGTTGACTACTGG 45 CTSDYTSGLAHVDYW :::::::::0:1:12:13:-11:-9:24:34:-6:45:::
2724 219 0.000132278 22 0.000130646 TGTGTTAAAGATGGTCAGGGGACATACAGCTATGCTTACTTTGCCTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(441.7) IGHD5-5*00(55) IGHJ4*00(397.8) IGHG100(103.3),IGHG200(103.3),IGHG400(103.3),IGHGP00(103.3) 442|454|473|0|12|SC446TSG447T|62.0 24|35|60|23|34||55.0 22|37|68|36|51|SA29CSA32T|92.0 ;;; TGTGTTAAAGATGGTCAGGGGACATACAGCTATGCTTACTTTGCCTTCTGG 45 CVKDGQGTYSYAYFAFW :::::::::0:1:12:23:-4:-5:34:36:-2:51:::
2743 218 0.000131674 23 0.000136584 TGTGCCAGGTCGTTTTACTATGGGAGGGGTGAGGTGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-30-2*00(418.1) IGHD3-1000(51),IGHD3-2200(46) IGHJ5*00(432.9) IGHA100(125.8),IGHA200(125.8) 445|453|476|0|8||80.0 30|43|93|10|23|SA33T|51.0;30|42|93|10|22|SA33T|46.0 27|40|71|35|48||130.0 ; TGTGCCAGGTCGTTTTACTATGGGAGGGGTGAGGTGTTCGACCCCTGG 45 CARSFYYGRGEVFDPW :::::::::0:-3:8:10:1:-19:23:35:-7:48:::
2744 218 0.000131674 22 0.000130646 TGTGCGAGTCTTAATGGGTATGATAATAGTGGTTTTTACTACGACAAGATTGGCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(387.6) IGHD3-22*00(97) IGHJ4*00(355) IGHA100(68.7),IGHA200(68.7) 445|453|476|0|8||80.0 38|63|93|18|43|SG45ASA54T|97.0 26|37|68|49|60|SA29G|81.0 ; TGTGCGAGTCTTAATGGGTATGATAATAGTGGTTTTTACTACGACAAGATTGGCTACTGG 45 CASLNGYDNSGFYYDKIGYW :::::::::0:-3:8:18:-7:1:43:49:-6:60:::
2745 218 0.000131674 23 0.000136584 TGTGCGAGATGGCGGGATAGCAGTGGCTGGCCACCTGGTGATGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-18*00(653.6) IGHD6-19*00(78) IGHJ4*00(310.2) nan 442|451|473|0|9||90.0 20|39|63|12|30|DT24|78.0 27|37|68|41|51||100.0 nan TGTGCGAGATGGCGGGATAGCAGTGGCTGGCCACCTGGTGATGACTACTGG 45 CARWRDSSGWPPGDDYW :::::::::0:-2:9:12:1:-3:30:41:-7:51:::
2746 218 0.000131674 25 0.000148461 TGTGCGAGAGATGGGGGATATTGTAATAGTGCCAGTTGCTATGGCCTACACTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(449.7) IGHD2-2*00(98) IGHJ5*00(446.6) nan 442|454|473|0|12||120.0 32|60|93|15|43|SG42ASA47GSC52T|98.0 23|40|71|49|66||170.0 nan TGTGCGAGAGATGGGGGATATTGTAATAGTGCCAGTTGCTATGGCCTACACTGGTTCGACCCCTGG 45 CARDGGYCNSASCYGLHWFDPW :::::::::0:1:12:15πŸ‘Ž-2:43:49:-3:66:::
2786 216 0.000130466 25 0.000148461 TGTGCGACCACCTATAGCAGTACGTCGAACGAGATTGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-33*00(688.7) IGHD6-600(51),IGHD6-1900(45) IGHJ4*00(152.7) nan 442|449|473|0|7||70.0 21|43|54|12|33|SC29TST30ADC34SG37A|51.0;24|33|63|12|21||45.0 26|37|68|34|45|ST31C|81.0 nan TGTGCGACCACCTATAGCAGTACGTCGAACGAGATTGACCACTGG 45 CATTYSSTSNEIDHW :::::::::0:-4:7:12:-3:7:33:34:-6:45:::
2787 216 0.000130466 27 0.000160338 TGTGCGAGAATAGCTGTGGCTGACAGGGGGTTCGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(342.7) IGHD6-19*00(51) IGHJ5*00(344.5) IGHG100(148.5),IGHG200(148.5),IGHG400(148.5),IGHGP00(148.5) 442|451|473|0|9||90.0 25|38|63|9|22|SA30T|51.0 26|40|71|28|42|SC34TSC35T|82.0 ;;; TGTGCGAGAATAGCTGTGGCTGACAGGGGGTTCGACTTCTGG 45 CARIAVADRGFDFW :::::::::0:-2:9:9:-4:-4:22:28:-6:42:::
2788 216 0.000130466 25 0.000148461 TGTGCGAAAGGGCGACTAGGATATACTGGGATCTACGCCGCCGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-30*00(460.8) IGHD1-2600(47),IGHD2-1500(45),IGHD2-2*00(45) IGHJ4*00(395.7) IGHG100(104),IGHG200(104),IGHG400(104),IGHGP00(104) 442|452|473|0|10||100.0 22|37|60|21|36|SG26CSG32T|47.0;29|38|93|15|24||45.0;29|38|93|15|24||45.0 28|37|68|42|51||90.0 ;;; TGTGCGAAAGGGCGACTAGGATATACTGGGATCTACGCCGCCGACTACTGG 45 CAKGRLGYTGIYAADYW :::::::::0:-1:10:21:-2:-3:36:42:-8:51:::
2790 216 0.000130466 15 8.90768e-05 TGTGCACGGTACGATTTTTACGGTGGTTCTTCGAATGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-26*00(914.1) IGHD3-3*00(54) IGHJ4*00(199) nan 445|454|478|0|9||90.0 35|57|93|9|31|SG45ASG46CSA47GSA54C|54.0 27|37|68|35|45||100.0 nan TGTGCACGGTACGATTTTTACGGTGGTTCTTCGAATGACTACTGG 45 CARYDFYGGSSNDYW :::::::::0:-4:9:9:-4:-5:31:35:-7:45:::
2793 216 0.000130466 21 0.000124708 TGTGCAAAAGATGGGGGGAGAGATGGCTACAAGTGGCTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-9*00(666.7) IGHD5-24*00(45) IGHJ5*00(187.3) nan 442|454|475|0|12||120.0 22|31|60|18|27||45.0 19|40|71|27|48|SC24GST28C|152.0 nan TGTGCAAAAGATGGGGGGAGAGATGGCTACAAGTGGCTCGACCCCTGG 45 CAKDGGRDGYKWLDPW :::::::::0:-1:12:18:-2:-9:27:27:1:48:::
2808 215 0.000129862 19 0.000112831 TGTGCGAGAGTTTTGCGTATGACAGCACCTGGTCCACACTTATACTTCGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-31*00(419) IGHD6-13*00(43) IGHJ2*00(376.7) IGHA100(79.8),IGHA200(79.8) 445|455|476|0|10||100.0 23|40|63|16|33|SA27GSG28ASG34C|43.0 27|42|73|42|57||150.0 ; TGTGCGAGAGTTTTGCGTATGACAGCACCTGGTCCACACTTATACTTCGATCTCTGG 45 CARVLRMTAPGPHLYFDLW :::::::::0:-1:10:16:-2:-2:33:42:-7:57:::
2809 215 0.000129862 18 0.000106892 TGTGCACACAGCCTATGGTTCGGGGAATTATCTCCCTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-5*00(900.3) IGHD3-10*00(67) IGHJ4*00(199.2) nan 445|456|478|0|11||110.0 37|56|93|12|31|SA46GSG51A|67.0 24|37|68|35|48||130.0 nan TGTGCACACAGCCTATGGTTCGGGGAATTATCTCCCTTTGACTACTGG 45 CAHSLWFGELSPFDYW :::::::::0:-2:11:12:-6:-6:31:35:-4:48:::
2834 213 0.000128654 22 0.000130646 TGTTGGGGGGAGCTTCCTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-1100(746.1),IGHV3-2100(742.5) IGHD1-2600(35),IGHD3-1600(35) IGHJ4*00(344) nan 442|445|473|0|3||30.0;442|445|473|0|3||30.0 28|35|60|7|14||35.0;54|61|111|5|12||35.0 27|37|68|17|27||100.0 nan TGTTGGGGGGAGCTTCCTGACTACTGG 45 CWGELPDYW :::::::::0:-8:3:7:-8:-5:14:17:-7:27:::
2849 213 0.000128654 22 0.000130646 TGTGCCAGGGGGCCGAACTGGGATGATTCTTTTGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-30-2*00(408) IGHD7-2700(35),IGHD1-100(30),IGHD1-7*00(30) IGHJ3*00(357.4) IGHG100(157.1),IGHG200(157.1),IGHG400(157.1),IGHGP00(157.1) 445|453|476|0|8||80.0 13|20|33|15|22||35.0;22|28|51|15|21||30.0;22|28|51|15|21||30.0 19|39|70|22|42|SG24TSA33C|142.0 ;;; TGTGCCAGGGGGCCGAACTGGGATGATTCTTTTGATCTCTGG 45 CARGPNWDDSFDLW :::::::::0:-3:8:15:-2:-2:22:22:1:42:::
2851 213 0.000128654 22 0.000130646 TGTGCGAGAGAATCAAGTACAACTGAGGAGGGCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(840.7) IGHD1-1*00(45) IGHJ4*00(227.1) nan 442|453|473|0|11||110.0 18|27|51|16|25||45.0 30|37|68|32|39||70.0 nan TGTGCGAGAGAATCAAGTACAACTGAGGAGGGCTACTGG 45 CARESSTTEEGYW :::::::::0:0:11:16πŸ‘Ž-7:25:32:-10:39:::
2852 213 0.000128654 20 0.000118769 TGTGCAAGAGCCCTCAACTGGAACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(1019) IGHD1-100(40),IGHD1-2000(35),IGHD1-7*00(35) IGHJ4*00(325.3) nan 442|452|473|0|10||100.0 21|29|51|14|22||40.0;22|29|51|15|22||35.0;22|29|51|15|22||35.0 23|37|68|22|36||140.0 nan TGTGCAAGAGCCCTCAACTGGAACTTTGACTACTGG 45 CARALNWNFDYW :::::::::0:-1:10:14:-4:-5:22:22:-3:36:::
2865 212 0.00012805 23 0.000136584 TGTGTGAAAGATCACTATAGTGGGAGATACTCACAGTTCGGGTACTTCGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(374.9) IGHD1-26*00(66) IGHJ2*00(458.1) IGHG100(73.3),IGHG200(73.3),IGHG400(73.3),IGHGP00(73.3) 442|455|473|0|13|SC446T|101.0 22|38|60|15|31|SC33A|66.0 25|42|73|40|57||170.0 ;;; TGTGTGAAAGATCACTATAGTGGGAGATACTCACAGTTCGGGTACTTCGATCTCTGG 45 CVKDHYSGRYSQFGYFDLW :::::::::0:2:13:15:-2:-2:31:40:-5:57:::
2866 212 0.00012805 23 0.000136584 TGTGTAAGAGAGCTGGTCGGGTCGAGGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(911.5) IGHD6-600(27),IGHD6-1300(25),IGHD6-25*00(25) IGHJ4*00(267.7) nan 442|456|473|0|14|SC446TST453G|82.0 32|43|54|15|26|SC35GSA38T|27.0;20|25|63|17|22||25.0;17|22|54|17|22||25.0 28|37|68|27|36||90.0 nan TGTGTAAGAGAGCTGGTCGGGTCGAGGGACTACTGG 45 CVRELVGSRDYW :::::::::0:3:14:15:-14:7:26:27:-8:36:::
2870 212 0.00012805 24 0.000142523 TGTGCGCGACATGAGACTACTGTGACTACTTTTGATGCTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(484.4) IGHD4-17*00(61) IGHJ3*00(466.9) IGHA100(113.4),IGHA200(113.4) 445|458|476|0|13|SA451C|101.0 17|32|48|14|29|SG23T|61.0 20|39|70|32|51||190.0 ; TGTGCGCGACATGAGACTACTGTGACTACTTTTGATGCTTTTGATATCTGG 45 CARHETTVTTFDAFDIW :::::::::0:2:13:14πŸ‘Ž0:29:32:0:51:::
2871 212 0.00012805 22 0.000130646 TGTGCAGGAGGCGCGGTGGGTGCTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(803.4) IGHD4-23*00(30) IGHJ3*00(322.9) nan 442|452|473|0|10|SA448G|71.0 25|31|57|13|19||30.0 23|39|70|20|36||160.0 nan TGTGCAGGAGGCGCGGTGGGTGCTTTTGATATCTGG 45 CAGGAVGAFDIW :::::::::0:-1:10:13:-6:-7:19:20:-3:36:::
2892 211 0.000127446 21 0.000124708 TGTGCGAGAGGGATCAGTTACTACTACGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(915.1) IGHD7-27*00(25) IGHJ6*00(359.6) nan 442|452|473|0|10|SA449G|71.0 19|24|33|10|15||25.0 28|52|83|18|42||240.0 nan TGTGCGAGAGGGATCAGTTACTACTACGGTATGGACGTCTGG 45 CARGISYYYGMDVW :::::::::0:-1:10:10:-8:2:15:18:-8:42:::
2893 211 0.000127446 18 0.000106892 TGTACCACAGGTCCCGACCCGGGAAATGGTGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-15*00(675.8) IGHD6-1300(35),IGHD6-1900(35),IGHD6-25*00(35) IGHJ4*00(172.9) nan 448|461|479|0|13|SA458G|101.0 17|24|63|16|23||35.0;17|24|63|16|23||35.0;14|21|54|16|23||35.0 27|37|68|29|39|ST31C|71.0 nan TGTACCACAGGTCCCGACCCGGGAAATGGTGACCACTGG 45 CTTGPDPGNGDHW :::::::::0:2:13:16:4:-18:23:29:-7:39:::
2905 210 0.000126842 20 0.000118769 TGTGCGACAGGGGACTACTGG NNNNNNNNNNNNNNNNNNNNN IGHV1-8*00(354.1) nan IGHJ4*00(369) IGHM*00(206.9) 442|453|473|0|11|SG449C|81.0 nan 28|37|68|12|21||90.0 nan TGTGCGACAGGGGACTACTGG 45 CATGDYW :::::::::0:0:11:::::12:-8:21:::
2907 210 0.000126842 22 0.000130646 TGTGCAAGAGAGGGCAATGACCGCTATGACTACGGACCTAACTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-1100(235.8),IGHV3-7100(235.8) IGHD4-1700(50),IGHD4-2300(50) IGHJ5*00(479.1) IGHA100(73),IGHA200(73) 442|453|473|0|11|SG447A|81.0;448|459|479|0|11|SG453A|81.0 15|25|48|25|35||50.0;18|28|57|25|35||50.0 22|40|71|39|57||180.0 ; TGTGCAAGAGAGGGCAATGACCGCTATGACTACGGACCTAACTGGTTCGACCCCTGG 45 CAREGNDRYDYGPNWFDPW :::::::::0:0:11:25:1:-7:35:39:-2:57:::
2919 209 0.000126238 19 0.000112831 TGTGCGAGAGCGAGAGCGAGGGGAGACGGGGCTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-59*00(821.1) IGHD3-16*00(30) IGHJ3*00(261.2) nan 439|449|470|0|10||100.0 55|61|111|19|25||30.0 24|39|70|30|45||150.0 nan TGTGCGAGAGCGAGAGCGAGGGGAGACGGGGCTTTTGATATCTGG 45 CARARARGDGAFDIW :::::::::0:-1:10:19:-18:-13:25:30:-4:45:::
2935 208 0.000125634 24 0.000142523 TGTGTGAAAGGCTTTAGCAGCTCGTCTCGCAGCCACTTTGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-43*00(694.9) IGHD6-6*00(60) IGHJ4*00(176.3) nan 442|452|475|0|10|SC446TSA447G|42.0 23|35|54|14|26||60.0 23|37|68|34|48|ST31C|111.0 nan TGTGTGAAAGGCTTTAGCAGCTCGTCTCGCAGCCACTTTGACCACTGG 45 CVKGFSSSSRSHFDHW :::::::::0:-3:10:14:-5:-1:26:34:-3:48:::
2939 208 0.000125634 24 0.000142523 TGTGCGACAGTAACATATTGTGGTGGTGACTGCTATGGTGCTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(852.5),IGHV3-700(852.5) IGHD2-21*00(92) IGHJ3*00(179.5) nan 442|452|473|0|10|SG449C|71.0;442|452|473|0|10|SG449C|71.0 27|51|84|10|34|SG29AST46C|92.0 19|39|70|34|54|SA22G|171.0 nan TGTGCGACAGTAACATATTGTGGTGGTGACTGCTATGGTGCTTTTGATATCTGG 45 CATVTYCGGDCYGAFDIW :::::::::0:-1:10:10:1:-5:34:34:1:54:::
2940 208 0.000125634 21 0.000124708 TGTGCGAGTGGGGACCACCTTTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-18*00(629.3) IGHD2-1500(30),IGHD4-2300(30),IGHD7-27*00(30) IGHJ4*00(361.3) IGHM*00(120) 442|450|473|0|8||80.0 12|18|93|13|19||30.0;6|12|57|13|19||30.0;16|22|33|8|14||30.0 31|37|68|21|27||60.0 nan TGTGCGAGTGGGGACCACCTTTACTGG 45 CASGDHLYW :::::::::0:-3:8:13:19:-44:19:21:-11:27:::
2941 208 0.000125634 19 0.000112831 TGTGCGAGACGGGGTAGTAGTGGCCCAAGCCCCCACTACTACTACGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-18*00(620) IGHD3-2200(45),IGHD2-200(40) IGHJ6*00(437.6) nan 442|451|473|0|9||90.0 43|52|93|14|23||45.0;39|47|93|13|21||40.0 26|52|83|34|60||260.0 nan TGTGCGAGACGGGGTAGTAGTGGCCCAAGCCCCCACTACTACTACGGTATGGACGTCTGG 45 CARRGSSGPSPHYYYGMDVW :::::::::0:-2:9:14:-12:-10:23:34:-6:60:::
2942 208 0.000125634 21 0.000124708 TGTGCGAGAGATATCATGGCCCCTTGG NNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-8*00(783) IGHD3-22*00(30) IGHJ5*00(293.1) nan 442|452|473|0|10||100.0 17|23|93|11|17||30.0 33|40|71|20|27|SC36T|41.0 nan TGTGCGAGAGATATCATGGCCCCTTGG 45 CARDIMAPW :::::::::0:-1:10:11:14:-39:17:20:-13:27:::
2943 208 0.000125634 22 0.000130646 TGTGCGAGAGAAGGTAGCAGCAGCTGTTTCGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-11*00(757.3) IGHD6-13*00(60) IGHJ2*00(237.3) nan 442|453|473|0|11||110.0 26|38|63|14|26||60.0 30|42|73|27|39||120.0 nan TGTGCGAGAGAAGGTAGCAGCAGCTGTTTCGATCTCTGG 45 CAREGSSSCFDLW :::::::::0:0:11:14:-5:-4:26:27:-10:39:::
2956 207 0.00012503 25 0.000148461 TGTGTGAAAGATCGCTATGTGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-66*00(692.9) nan IGHJ6*00(325) nan 439|455|470|0|16|SC443TSG446AST452G|73.0 nan 41|52|83|19|30||110.0 nan TGTGTGAAAGATCGCTATGTGGACGTCTGG 45 CVKDRYVDVW :::::::::0:5:16:::::19:-21:30:::
2957 207 0.00012503 24 0.000142523 TGTGTAAGAGGGAGTTTTGGTTACGGCGTTTTTGAATACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(782.8) IGHD5-500(40),IGHD3-1600(37) IGHJ4*00(215.2) nan 442|452|473|0|10|SC446T|71.0 33|41|60|17|25||40.0;57|70|111|10|23|SA63TSC65G|37.0 25|37|68|30|42|SC30A|91.0 nan TGTGTAAGAGGGAGTTTTGGTTACGGCGTTTTTGAATACTGG 45 CVRGSFGYGVFEYW :::::::::0:-1:10:17:-13:1:25:30:-5:42:::
2973 206 0.000124426 22 0.000130646 TGTGCGACCCGGACCAACCATTGTAGTGATGGTAGCTGCTATTGGGCGTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-2*00(723) IGHD2-15*00(96) IGHJ3*00(160.9) nan 442|449|473|0|7||70.0 36|58|93|19|41|SG45A|96.0 24|39|70|45|60|ST26G|121.0 nan TGTGCGACCCGGACCAACCATTGTAGTGATGGTAGCTGCTATTGGGCGTTTGATATCTGG 45 CATRTNHCSDGSCYWAFDIW :::::::::0:-4:7:19:-5:-4:41:45:-4:60:::
2974 206 0.000124426 23 0.000136584 TGTGCGAGGGGCAGCAGTGGCCGGGGGCCGTTGTTTGCCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-3*00(730) IGHD6-19*00(46) IGHJ4*00(214.6) nan 442|450|473|0|8||80.0 27|39|63|12|24|ST36C|46.0 25|37|68|33|45|SA29C|91.0 nan TGTGCGAGGGGCAGCAGTGGCCGGGGGCCGTTGTTTGCCTACTGG 45 CARGSSGRGPLFAYW :::::::::0:-3:8:12:-6:-3:24:33:-5:45:::
2975 206 0.000124426 22 0.000130646 TGTGCGAGATATTCCACACAGGGTATAAAACTGGCCGATCACTTTGACCAGTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(457.4) IGHD3-300(38),IGHD6-1300(35),IGHD6-25*00(35) IGHJ4*00(301.6) IGHA100(95.7),IGHA200(95.7) 442|454|473|0|12|SC451T|91.0 0|11|93|21|31|DT7|38.0;21|28|63|20|27||35.0;18|25|54|20|27||35.0 23|37|68|40|54|ST31CSC33G|82.0 ; TGTGCGAGATATTCCACACAGGGTATAAAACTGGCCGATCACTTTGACCAGTGG 45 CARYSTQGIKLADHFDQW :::::::::0:1:12:21:31:-51:31:40:-3:54:::
2976 206 0.000124426 19 0.000112831 TGTGCGAGAGGCTCACTAATTTCTGACTGCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-7*00(863.9) IGHD5-1800(28),IGHD3-2200(25),IGHD5-12*00(25) IGHJ4*00(283.5) nan 442|452|473|0|10||100.0 11|20|69|13|21|DT16|28.0;11|16|93|13|18||25.0;11|16|69|13|18||25.0 27|37|68|23|33|SA32G|71.0 nan TGTGCGAGAGGCTCACTAATTTCTGACTGCTGG 45 CARGSLISDCW :::::::::0:-1:10:13:12:-26:21:23:-7:33:::
2977 206 0.000124426 21 0.000124708 TGTGCGAGAGACCTGGCCGAGTTTAGTCGGTGGTCCGGTCACCAGTATGGCTACATGGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-4*00(440) IGHD2-800(40),IGHD5-2400(40),IGHD2-15*00(38) IGHJ6*00(243.5) IGHA100(40),IGHA200(40) 442|456|473|0|14|ST453C|111.0 14|22|93|39|47||40.0;26|34|60|46|54||40.0;40|50|93|23|34|I44C|38.0 40|52|83|54|66|SG46T|91.0 ; TGTGCGAGAGACCTGGCCGAGTTTAGTCGGTGGTCCGGTCACCAGTATGGCTACATGGACTTCTGG 45 CARDLAEFSRWSGHQYGYMDFW :::::::::0:3:14:39:17:-40:47:54:-20:66:::
2978 206 0.000124426 18 0.000106892 TGTGCGAAAGCACCCCAGGGGGACCCATTCTTTGACCAGTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-400(274.6),IGHV4-5500(274) IGHD3-1600(30),IGHD7-2700(30),IGHD2-8*00(28) IGHJ4*00(372.7) IGHA100(152.1),IGHA200(152.1) 442|452|473|0|10|SG449A|71.0;442|449|473|0|7||70.0 54|60|111|17|23||30.0;1|7|33|12|18||30.0;11|20|93|10|18|DA15|28.0 24|37|68|29|42|ST31CSC33G|72.0 ; TGTGCGAAAGCACCCCAGGGGGACCCATTCTTTGACCAGTGG 45 CAKAPQGDPFFDQW :::::::::0:-1:10:17:-17:-14:23:29:-4:42:::
2979 206 0.000124426 22 0.000130646 TGTGCGAAAGATCTGAGCTGGGGGTACACTTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(789.3) IGHD2-200(30),IGHD6-1300(30),IGHD6-6*00(30) IGHJ4*00(219.8) nan 442|456|473|0|14||140.0 8|14|93|15|21||30.0;33|39|63|15|21||30.0;4|10|54|14|20||30.0 25|37|68|30|42||120.0 nan TGTGCGAAAGATCTGAGCTGGGGGTACACTTTTGACTACTGG 45 CAKDLSWGYTFDYW :::::::::0:3:14:15:23:-48:21:30:-5:42:::
2995 205 0.000123822 19 0.000112831 TGTGTGAGGGATGTTGAATTTAGCGGAGGCCGCGAAATCGGAGACTGCTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-18*00(688.6) IGHD5-1800(32),IGHD3-300(30),IGHD5-24*00(28) IGHJ5*00(312.3) nan 442|454|473|0|12|SC446TSA450G|62.0 24|36|69|14|26|SA29TST33C|32.0;19|25|93|34|40||30.0;2|11|60|16|24|DG6|28.0 23|40|71|43|60|SG27C|141.0 nan TGTGTGAGGGATGTTGAATTTAGCGGAGGCCGCGAAATCGGAGACTGCTTCGACCCCTGG 45 CVRDVEFSGGREIGDCFDPW :::::::::0:1:12:14πŸ‘Ž-10:26:43:-3:60:::
3002 205 0.000123822 20 0.000118769 TGTGCGAAAGGGATCAGTTACTACTACGATATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(953.3) IGHD7-27*00(25) IGHJ6*00(327.7) nan 442|452|473|0|10||100.0 19|24|33|10|15||25.0 28|52|83|18|42|SG38A|211.0 nan TGTGCGAAAGGGATCAGTTACTACTACGATATGGACGTCTGG 45 CAKGISYYYDMDVW :::::::::0:-1:10:10:-8:2:15:18:-8:42:::
3003 205 0.000123822 21 0.000124708 TGTGCGAAAGATTACTACGGTGCTAACTCTTTCTATTTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-30*00(439.4) IGHD4-23*00(66) IGHJ4*00(349.9) IGHA100(118.2),IGHA200(118.2) 442|454|473|0|12||120.0 21|37|57|13|29|SG30C|66.0 21|37|68|32|48|SC24TSA32C|102.0 ; TGTGCGAAAGATTACTACGGTGCTAACTCTTTCTATTTTGACTCCTGG 45 CAKDYYGANSFYFDSW :::::::::0:1:12:13:-2:-1:29:32πŸ‘Ž48:::
3004 205 0.000123822 18 0.000106892 TGTGCGAAAGACCTAGGATACTGTACTGGTGGTAGGTGCCCCAACGCGGACTGGTTCAACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-2*00(590.2) IGHD2-1500(83),IGHD2-800(81) IGHJ5*00(401.1) nan 442|456|473|0|14|SG449AST453C|82.0 31|56|93|14|39|ST37CSG42CSC52G|83.0;31|50|93|14|33|ST37C|81.0 23|40|71|49|66|SG31A|141.0 nan TGTGCGAAAGACCTAGGATACTGTACTGGTGGTAGGTGCCCCAACGCGGACTGGTTCAACCCCTGG 45 CAKDLGYCTGGRCPNADWFNPW :::::::::0:3:14:14:0:-6:39:49:-3:66:::
3005 205 0.000123822 23 0.000136584 TGTGCACACAGGCGAGGGGGCTACAATTGGAACGACGGTGACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-5*00(986.7) IGHD1-1*00(66) IGHJ4*00(150) nan 445|459|478|0|14|SA456G|111.0 19|35|51|21|37|SC24T|66.0 23|37|68|40|54||140.0 nan TGTGCACACAGGCGAGGGGGCTACAATTGGAACGACGGTGACTTTGACTACTGG 45 CAHRRGGYNWNDGDFDYW :::::::::0:1:14:21:-2:1:37:40:-3:54:::
3006 205 0.000123822 19 0.000112831 TGTGACAGTGGCAAATTTTGG NNNNNNNNNNNNNNNNNNNNN IGHV3-30*00(530.6) IGHD6-1900(35),IGHD5-1200(30),IGHD5-18*00(30) IGHJ4*00(228.5) nan 442|446|473|0|4||40.0 29|36|63|5|12||35.0;31|37|69|6|12||30.0;31|37|69|6|12||30.0 34|37|68|18|21||30.0 nan TGTGACAGTGGCAAATTTTGG 45 CDSGKFW :::::::::0:-7:4:5:-8:-6:12:18:-14:21:::
3007 205 0.000123822 23 0.000136584 TGTACGAGATCAGGCAACAGTTGGTCAAGGAAAAACTATTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-34*00(469.6) IGHD6-1300(32),IGHD1-100(30) IGHJ5*00(399.9) IGHA100(111.6),IGHA200(111.6) 439|448|470|0|9|SG442A|61.0 28|40|63|13|25|SG31ASC35T|32.0;7|13|51|17|23||30.0 22|40|71|33|51|SG26ASG27T|122.0 ; TGTACGAGATCAGGCAACAGTTGGTCAAGGAAAAACTATTTCGACCCCTGG 45 CTRSGNSWSRKNYFDPW :::::::::0:-2:9:13:-7:-2:25:33:-2:51:::
3025 204 0.000123217 17 0.000100954 TGTGTCTACCGTGGTTACTGG NNNNNNNNNNNNNNNNNNNNN IGHV1-8*00(666.3) IGHD4-23*00(36) IGHJ4*00(306.5) nan 442|446|473|0|4||40.0 22|32|57|5|15|SG26C|36.0 31|37|68|15|21||60.0 nan TGTGTCTACCGTGGTTACTGG 45 CVYRGYW :::::::::0:-7:4:5:-3:-6:15:15:-11:21:::
3042 203 0.000122613 21 0.000124708 TGTGCGACTGCTAAGGTAGTAGTCCTACCGTATGTTAGCTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(962.8) IGHD2-200(40),IGHD1-2600(39),IGHD3-22*00(37) IGHJ5*00(187.8) nan 445|452|476|0|7||70.0 39|47|93|15|23||40.0;0|14|60|15|28|DC7SC11T|39.0;37|50|93|10|23|ST40ASA42G|37.0 24|40|71|38|54||160.0 nan TGTGCGACTGCTAAGGTAGTAGTCCTACCGTATGTTAGCTGGTTCGACCCCTGG 45 CATAKVVVLPYVSWFDPW :::::::::0:-4:7:15:-8:-15:23:38:-4:54:::
3043 203 0.000122613 19 0.000112831 TGTGCGAAAGGGATCAATTACTACTACGATATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(965.2) IGHD7-27*00(25) IGHJ6*00(324.7) nan 442|452|473|0|10||100.0 19|24|33|10|15||25.0 28|52|83|18|42|SG38A|211.0 nan TGTGCGAAAGGGATCAATTACTACTACGATATGGACGTCTGG 45 CAKGINYYYDMDVW :::::::::0:-1:10:10:-8:2:15:18:-8:42:::
3046 203 0.000122613 18 0.000106892 TGTGCAAAAGATAAACCGTATCATTTTGATACTGAGGGTCATTTCCCCTTTGACTACATG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(389.7) IGHD4-1700(38),IGHD4-2300(38),IGHD3-22*00(36) IGHJ4*00(343.9) IGHA100(59.2),IGHA200(59.2) 442|454|473|0|12|SG447A|91.0 6|17|48|14|24|DG12|38.0;9|20|57|14|24|DG15|38.0;30|57|93|16|43|ST35CSC37TSA39TSG45CI47GDT49ST53C|36.0 24|37|68|47|60|ST34ASG35T|72.0 ; TGTGCAAAAGATAAACCGTATCATTTTGATACTGAGGGTCATTTCCCCTTTGACTACATG 45 CAKDKPYHFDTEGHFPFDYM :::::::::0:1:12:14:10:-15:24:47:-4:60:::
3061 202 0.000122009 26 0.0001544 TGTGTAAGGGCTATGCGATTCATTTATGACATTGACTTTTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(582.7) IGHD2-200(35),IGHD3-1600(33),IGHD5-5*00(30) IGHJ4*00(154.4) nan 442|446|473|0|4||40.0 54|61|93|9|16||35.0;44|54|111|16|25|DA48|33.0;29|35|60|9|15||30.0 23|37|68|28|42|ST25ASA32TSC33T|53.0 nan TGTGTAAGGGCTATGCGATTCATTTATGACATTGACTTTTGG 45 CVRAMRFIYDIDFW :::::::::0:-7:4:9:-23:-1:16:28:-3:42:::
3067 202 0.000122009 20 0.000118769 TGTGCGGGTGCCGAACATTGTACTAATGGTGTATGCTATATTCCGCCCCGCCTCTACTGGTACTTCGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-69D*00(409.9) IGHD2-8*00(92) IGHJ2*00(389.1) nan 442|448|473|0|6||60.0 36|60|93|16|40|SG44ASG45A|92.0 20|42|73|53|75||220.0 nan TGTGCGGGTGCCGAACATTGTACTAATGGTGTATGCTATATTCCGCCCCGCCTCTACTGGTACTTCGATCTCTGG 45 CAGAEHCTNGVCYIPPRLYWYFDLW :::::::::0:-5:6:16:-5:-2:40:53:0:75:::
3070 202 0.000122009 25 0.000148461 TGTGCAAGGGATCGTGGGGGCTGGCACTCTGCTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV6-1*00(516) IGHD1-2600(31),IGHD2-200(31),IGHD6-19*00(31) IGHJ3*00(467.6) IGHM*00(142) 454|467|485|0|13|SA462G|101.0 26|35|60|13|22|SA31G|31.0;9|18|93|19|28|ST14C|31.0;33|42|63|18|27|ST39C|31.0 23|39|70|29|45||160.0 nan TGTGCAAGGGATCGTGGGGGCTGGCACTCTGCTTTTGATATCTGG 45 CARDRGGWHSAFDIW :::::::::0:2:13:13:-6:-5:22:29:-3:45:::
3085 201 0.000121405 20 0.000118769 TGTGCGAAAGACGACTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(925.4) nan IGHJ4*00(402.7) nan 442|453|473|0|11||110.0 nan 20|37|68|13|30||170.0 nan TGTGCGAAAGACGACTACTTTGACTACTGG 45 CAKDDYFDYW :::::::::0:0:11:::::13:0:30:::
3104 200 0.000120801 22 0.000130646 TGTGCGAGAGCTGACCAGACGGTTGATGCTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-31*00(417.2) IGHD2-200(25),IGHD4-2300(25),IGHD6-13*00(25) IGHJ3*00(476.9) IGHM*00(151.5) 445|455|476|0|10||100.0 47|52|93|13|18||25.0;24|29|57|18|23||25.0;2|7|63|13|18||25.0 20|39|70|23|42||190.0 nan TGTGCGAGAGCTGACCAGACGGTTGATGCTTTTGATATCTGG 45 CARADQTVDAFDIW :::::::::0:-1:10:13:-16:-10:18:23:0:42:::
3105 200 0.000120801 21 0.000124708 TGTGCGAGAGGCGCGGATTTGTACGGTGACTTCTTGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(808.6),IGHV3-700(808.6) IGHD2-8*00(46) IGHJ4*00(204.7) nan 442|452|473|0|10||100.0;442|452|473|0|10||100.0 32|48|93|14|28|DA36DT43|46.0 20|37|68|28|45|SA23TST27G|112.0 nan TGTGCGAGAGGCGCGGATTTGTACGGTGACTTCTTGGACTACTGG 45 CARGADLYGDFLDYW :::::::::0:-1:10:14πŸ‘Ž-14:28:28:0:45:::
3106 200 0.000120801 15 8.90768e-05 TGTGCAAGATCGGCATTAGCCAGTCGAGGAAGCACCTCATCGGGAGACTATGACTTTGATTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-46*00(209.8) IGHD6-6*00(42) IGHJ3*00(280.8) nan 442|451|473|0|9|SG447A|61.0 16|39|54|23|45|ST21GDT23SG28CSG32ASC35G|42.0 27|39|70|54|66|SA33T|91.0 nan TGTGCAAGATCGGCATTAGCCAGTCGAGGAAGCACCTCATCGGGAGACTATGACTTTGATTTCTGG 45 CARSALASRGSTSSGDYDFDFW :::::::::0:-2:9:23:2:3:45:54:-7:66:::
3120 199 0.000120197 19 0.000112831 TGTGTGAAAGGGCCTTTTTCGGCTCCTCTGTATCATCTTGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(389.8) IGHD5-500(35),IGHD4-1100(33),IGHD4-4*00(33) IGHJ4*00(322.1) IGHA100(117.3),IGHA200(117.3) 442|452|473|0|10|SC446T|71.0 10|17|60|27|34||35.0;7|17|48|27|36|DG12|33.0;7|17|48|27|36|DG12|33.0 26|37|68|37|48|ST31GSA32T|52.0 ; TGTGTGAAAGGGCCTTTTTCGGCTCCTCTGTATCATCTTGACGTCTGG 45 CVKGPFSAPLYHLDVW :::::::::0:-1:10:27:10:-23:34:37:-6:48:::
3124 199 0.000120197 26 0.0001544 TGTGCGAGAGATGTCTTGCTCGACAGCGGCTGGCACGATTACTATTTTGACCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-69D*00(677.2) IGHD6-1300(42),IGHD6-1900(42),IGHD6-25*00(40) IGHJ4*00(215.1) nan 442|461|473|0|19|SC454GSC458T|132.0 29|43|63|23|37|SA33GST39C|42.0;29|43|63|23|37|ST32CST39C|42.0;26|34|54|23|31||40.0 19|37|68|39|57|SC24TST31CSA32T|93.0 nan TGTGCGAGAGATGTCTTGCTCGACAGCGGCTGGCACGATTACTATTTTGACCTCTGG 45 CARDVLLDSGWHDYYFDLW :::::::::0:8:19:23:-8:1:37:39:1:57:::
3126 199 0.000120197 19 0.000112831 TGTGCAAGAGGAAACGTTGGTTTCGGGTTTTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(1018.9) IGHD1-1400(34),IGHD3-1000(30),IGHD3-9*00(30) IGHJ4*00(212.2) nan 442|452|473|0|10||100.0 32|44|51|13|26|I35TSC40T|34.0;59|65|93|12|18||30.0;59|65|93|12|18||30.0 25|37|68|30|42||120.0 nan TGTGCAAGAGGAAACGTTGGTTTCGGGTTTTTTGACTACTGG 45 CARGNVGFGFFDYW :::::::::0:-1:10:13:-15:10:26:30:-5:42:::
3135 198 0.000119593 22 0.000130646 TGTGTGAGAGATGGGGAATTCCCCTTAAGCATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(824.4) IGHD3-1600(26),IGHD7-2700(26),IGHD2-21*00(25) IGHJ6*00(241.4) nan 442|454|473|0|12|SC446TSA447G|62.0 11|19|111|16|24|SC13T|26.0;17|27|33|12|24|I21AI22T|26.0;0|5|84|14|19||25.0 40|52|83|30|42||120.0 nan TGTGTGAGAGATGGGGAATTCCCCTTAAGCATGGACGTCTGG 45 CVRDGEFPLSMDVW :::::::::0:1:12:16:26:-55:24:30:-20:42:::
3146 198 0.000119593 22 0.000130646 TGTGCGAGACGCAGAAACTATGTCTTCTGGTACTTCGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(359.5) IGHD4-1100(32),IGHD4-400(32),IGHD3-10*00(30) IGHJ2*00(488.8) IGHA100(136.2),IGHA200(136.2) 445|455|476|0|10||100.0 22|34|48|11|23|ST25ASC31T|32.0;22|34|48|11|23|ST25ASC31T|32.0;36|42|93|16|22||30.0 20|42|73|23|45|SA22T|191.0 ; TGTGCGAGACGCAGAAACTATGTCTTCTGGTACTTCGATCTCTGG 45 CARRRNYVFWYFDLW :::::::::0:-1:10:11:-6:2:23:23:0:45:::
3147 198 0.000119593 16 9.50153e-05 TGTGCGAGAGATGTGGGGGAACTACTCGGTTTCGTGGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-34*00(482.5) IGHD1-700(40),IGHD1-2600(36),IGHD3-16*00(36) IGHJ5*00(330.6) IGHA100(138.9),IGHA200(138.9) 439|449|470|0|10||100.0 26|34|51|17|25||40.0;28|38|60|16|26|SG32A|36.0;50|60|111|10|20|ST52G|36.0 31|40|71|36|45|SC34T|61.0 ; TGTGCGAGAGATGTGGGGGAACTACTCGGTTTCGTGGACTCCTGG 45 CARDVGELLGFVDSW :::::::::0:-1:10:17:-9:0:25:36:-11:45:::
3164 197 0.000118989 18 0.000106892 TGTGCGAGACATGACTTTACGATTTTCCCCGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(594.3) IGHD3-3*00(50) IGHJ6*00(308.7) IGHA100(185.3),IGHA200(185.3) 445|461|476|0|16|ST458A|131.0 34|44|93|16|26||50.0 45|52|83|29|36||70.0 ; TGTGCGAGACATGACTTTACGATTTTCCCCGTCTGG 45 CARHDFTIFPVW :::::::::0:5:16:16:-3:-18:26:29:-25:36:::
3165 197 0.000118989 19 0.000112831 TGTGCGAGAAGGGTTGTAAGTGGCTGGTACGACTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-18*00(790.4) IGHD6-19*00(65) IGHJ4*00(412.1) nan 442|451|473|0|9||90.0 30|43|63|18|31||65.0 20|37|68|31|48||170.0 nan TGTGCGAGAAGGGTTGTAAGTGGCTGGTACGACTACTTTGACTACTGG 45 CARRVVSGWYDYFDYW :::::::::0:-2:9:18:-9:1:31:31:0:48:::
3166 197 0.000118989 20 0.000118769 TGTGCGAAAGATTTCATAGTGGCAATCGAGTTCGGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(953.4) IGHD5-1200(40),IGHD5-1800(40),IGHD3-22*00(35) IGHJ400(201),IGHJ500(201) nan 442|454|473|0|12||120.0 29|37|69|15|23||40.0;29|37|69|15|23||40.0;19|26|93|13|20||35.0 35|37|68|34|36||20.0;38|40|71|34|36||20.0 nan TGTGCGAAAGATTTCATAGTGGCAATCGAGTTCGGG 45 CAKDFIVAIEFG :::::::::0:1:12:15:-6:-9:23:34:-15:36:::
3180 196 0.000118385 19 0.000112831 TGTGTAAAAGGTAGCTCTGGTTACGGGGTCTTTGAGTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(445.8) IGHD5-5*00(51) IGHJ4*00(352.6) IGHA100(147.6),IGHA200(147.6) 442|452|473|0|10|SC446TSG449A|42.0 28|41|60|12|25|SA32C|51.0 24|37|68|29|42|SC30GSA32C|72.0 ; TGTGTAAAAGGTAGCTCTGGTTACGGGGTCTTTGAGTCCTGG 45 CVKGSSGYGVFESW :::::::::0:-1:10:12:-8:1:25:29:-4:42:::
3187 196 0.000118385 20 0.000118769 TGTGCGAGAGACCACAGTCAGGACTATGATTCGGGGAGTTGTTGGTGGCTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-46*00(711.6) IGHD3-10*00(63) IGHJ5*00(243.8) nan 442|453|473|0|11||110.0 36|57|93|22|43|SG42ASA46GSA54G|63.0 25|40|71|45|60|ST28C|121.0 nan TGTGCGAGAGACCACAGTCAGGACTATGATTCGGGGAGTTGTTGGTGGCTCGACCCCTGG 45 CARDHSQDYDSGSCWWLDPW :::::::::0:0:11:22:-5:-5:43:45:-5:60:::
3189 196 0.000118385 19 0.000112831 TGTGCAAGAGAGGATCGCAATAGCGAATTCTTAGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(785.3) IGHD3-300(35),IGHD3-900(35),IGHD2-21*00(34) IGHJ4*00(204.7) nan 442|453|473|0|11||110.0 21|36|93|13|29|ST25CI30GST32A|35.0;21|36|93|13|29|ST25CI30GST32A|35.0;55|67|84|15|28|SG57CI64G|34.0 24|37|68|29|42|ST27A|101.0 nan TGTGCAAGAGAGGATCGCAATAGCGAATTCTTAGACTACTGG 45 CAREDRNSEFLDYW :::::::::0:0:11:13:10:-26:29:29:-4:42:::
3190 196 0.000118385 22 0.000130646 TGTACCATAGACCTGGATGACAGTAGTAGTCATTCCTGCGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-15*00(407.6) IGHD3-22*00(49) IGHJ5*00(372.1) IGHM*00(117.3) 448|463|479|0|15|SC455TST459C|92.0 39|60|93|16|37|ST43CSG50AST53CSA57C|49.0 30|40|71|38|48|SC35A|71.0 nan TGTACCATAGACCTGGATGACAGTAGTAGTCATTCCTGCGACCACTGG 45 CTIDLDDSSSHSCDHW :::::::::0:4:15:16:-8:-2:37:38:-10:48:::
3214 195 0.000117781 21 0.000124708 TGTGCGAGACGCAGTAATTACGTCTTCTGGTACTTCGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(658) IGHD4-1100(46),IGHD4-400(46),IGHD5-24*00(40) IGHJ2*00(304.8) nan 445|455|476|0|10||100.0 22|34|48|11|23|SC28T|46.0;22|34|48|11|23|SC28T|46.0;34|42|60|15|23||40.0 20|42|73|23|45|SA22T|191.0 nan TGTGCGAGACGCAGTAATTACGTCTTCTGGTACTTCGATCTCTGG 45 CARRSNYVFWYFDLW :::::::::0:-1:10:11:-6:2:23:23:0:45:::
3215 195 0.000117781 19 0.000112831 TGTGCGAAAGATCTCCCATACCAGACAGCTGGTCCGTCCCACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(602.9) IGHD6-13*00(56) IGHJ4*00(417.4) IGHM*00(88) 442|456|473|0|14||140.0 25|47|63|17|40|SG28CI32ASA40CSA44C|56.0 23|37|68|40|54||140.0 nan TGTGCGAAAGATCTCCCATACCAGACAGCTGGTCCGTCCCACTTTGACTACTGG 45 CAKDLPYQTAGPSHFDYW :::::::::0:3:14:17:-4:5:40:40:-3:54:::
3230 194 0.000117177 17 0.000100954 TGTGCGACTAACAGTGTACAAGTGGCGGGTAGTTGGGCTTTTGATGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(387.3) IGHD6-1900(41),IGHD1-100(36) IGHJ3*00(177.6) IGHA100(111),IGHA200(111) 442|449|473|0|7||70.0 30|41|63|20|31|ST36G|41.0;18|28|51|15|25|SC24G|36.0 24|39|70|36|51|SA33G|121.0 ; TGTGCGACTAACAGTGTACAAGTGGCGGGTAGTTGGGCTTTTGATGTCTGG 45 CATNSVQVAGSWAFDVW :::::::::0:-4:7:20:-9:-1:31:36:-4:51:::
3231 194 0.000117177 20 0.000118769 TGTGCGAGGGCGACTACTGACTTTCAGTATTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-67*00(516) IGHD4-1700(31),IGHD3-2200(30),IGHD4-23*00(30) IGHJ4*00(276.9) IGHA100(149.6),IGHA200(149.6) 446|454|477|0|8|SG450C|51.0 23|32|48|8|17|ST25C|31.0;12|18|93|12|18||30.0;20|26|57|11|17||30.0 23|37|68|19|33|SG28CSC30GSC33T|53.0 ; TGTGCGAGGGCGACTACTGACTTTCAGTATTGG 45 CARATTDFQYW :::::::::0:-3:8:8:-7:0:17:19:-3:33:::
3232 194 0.000117177 21 0.000124708 TGTGCGAGAGATCGACTATGGTACGGGCACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-5900(486.2),IGHV4-6100(486.2) IGHD3-1000(40),IGHD5-500(38),IGHD6-13*00(35) IGHJ4*00(367) IGHA100(139.9),IGHA200(139.9) 439|452|470|0|13||130.0;445|458|476|0|13||130.0 36|44|93|14|22||40.0;30|41|60|15|25|DT36|38.0;36|43|63|18|25||35.0 23|37|68|28|42||140.0 ; TGTGCGAGAGATCGACTATGGTACGGGCACTTTGACTACTGG 45 CARDRLWYGHFDYW :::::::::0:2:13:14:-5:-18:22:28:-3:42:::
3233 194 0.000117177 21 0.000124708 TGTGCGAGAATTGAATGTAGTCGTGGTACCTGCTATGGGGTCGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-400(395.6),IGHV4-5500(395.6) IGHD2-15*00(72) IGHJ4*00(362.3) IGHM*00(100.8) 442|451|473|0|9||90.0;442|451|473|0|9||90.0 38|58|93|15|35|SG44CSG51C|72.0 28|37|68|42|51||90.0 nan TGTGCGAGAATTGAATGTAGTCGTGGTACCTGCTATGGGGTCGACTACTGG 45 CARIECSRGTCYGVDYW :::::::::0:-2:9:15:-7:-4:35:42:-8:51:::
3234 194 0.000117177 21 0.000124708 TGTGCACACAAGGTTTACGATATGTCCCCCTTTGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-5*00(872) IGHD3-9*00(45) IGHJ4*00(227.1) nan 445|455|478|0|10||100.0 34|43|93|14|23||45.0 24|37|68|29|42|SA32T|101.0 nan TGTGCACACAAGGTTTACGATATGTCCCCCTTTGACTTCTGG 45 CAHKVYDMSPFDFW :::::::::0:-3:10:14:-3:-19:23:29:-4:42:::
3253 193 0.000116573 19 0.000112831 TGCACCACAGACGGCCTTCACTGGGACACTGCTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-15*00(399.4) IGHD7-2700(30),IGHD1-700(26),IGHD3-9*00(26) IGHJ3*00(462.4) IGHM*00(131.3) 448|459|479|0|11|ST450C|81.0 14|20|33|19|25||30.0;23|31|51|19|27|SA28G|26.0;44|52|93|16|24|SG46C|26.0 23|39|70|29|45||160.0 nan TGCACCACAGACGGCCTTCACTGGGACACTGCTTTTGATATCTGG 45 CTTDGLHWDTAFDIW :::::::::0:0:11:19:-3:-2:25:29:-3:45:::
3274 192 0.000115969 24 0.000142523 TGTGCCAGAGGGAGGTCACAATATGATACTTTGACTGGTTATTATTCTTATGATACTTTTGATGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-30-2*00(462.1) IGHD3-9*00(92) IGHJ3*00(420.4) nan 445|455|476|0|10||100.0 35|59|93|21|45|SC37TST42C|92.0 19|39|70|49|69|SG24ASA33G|142.0 nan TGTGCCAGAGGGAGGTCACAATATGATACTTTGACTGGTTATTATTCTTATGATACTTTTGATGTCTGG 45 CARGRSQYDTLTGYYSYDTFDVW :::::::::0:-1:10:21:-4:-3:45:49:1:69:::
3284 191 0.000115365 14 8.31384e-05 TGTTCAACCTACACACAGGGCGGTCCTCCCGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(892.1) IGHD1-2600(25),IGHD2-1500(25),IGHD3-10*00(25) IGHJ4*00(245.1) nan 442|449|473|0|7|SG445T|41.0 7|12|60|25|30||25.0;19|24|93|8|13||25.0;10|15|93|25|30||25.0 28|37|68|30|39||90.0 nan TGTTCAACCTACACACAGGGCGGTCCTCCCGACTACTGG 45 CSTYTQGGPPDYW :::::::::0:-4:7:25:13:-28:30:30:-8:39:::
3292 191 0.000115365 18 0.000106892 TGTGTGCGAGGCCGGGGCGTCTCGGTTTATGGAGCGGAAGCGAACCATTACTACTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-8*00(448.9) IGHD3-1000(35),IGHD3-300(33),IGHD1-14*00(30) IGHJ6*00(270.1) nan 442|455|473|0|13|SC446TSA448C|72.0 16|23|93|41|48||35.0;37|52|93|22|37|SA39GST43AST49C|33.0;27|33|51|41|47||30.0 28|52|83|48|69|DG37DG38DT39|126.0 nan TGTGTGCGAGGCCGGGGCGTCTCGGTTTATGGAGCGGAAGCGAACCATTACTACTACATGGACGTCTGG 45 CVRGRGVSVYGAEANHYYYMDVW :::::::::0:2:13:41:15:-39:48:48:-8:69:::
3297 191 0.000115365 19 0.000112831 TGTGCGAGAGCGTTTCATTTTGGAGTGGTTATTACTACGCCTTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-11*00(270.2) IGHD3-300(88),IGHD3-2200(80) IGHJ4*00(397.5) IGHM*00(88.8) 442|452|473|0|10||100.0 41|61|93|17|38|I58C|88.0;47|63|93|23|39||80.0 25|37|68|42|54||120.0 nan TGTGCGAGAGCGTTTCATTTTGGAGTGGTTATTACTACGCCTTTTGACTACTGG 45 CARAFHFGVVITTPFDYW :::::::::0:-1:10:17:-10:-1:38:42:-5:54:::
3298 191 0.000115365 19 0.000112831 TGTGCGAGAGGAGTGGCTAGCAGGGGCCGCGACCCCTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-69D*00(855.2) IGHD5-1200(40),IGHD5-1800(40),IGHD6-25*00(36) IGHJ4*00(293.2) nan 442|452|473|0|10||100.0 31|39|69|11|19||40.0;31|39|69|11|19||40.0;23|33|54|17|27|SC29G|36.0 21|37|68|35|51||160.0 nan TGTGCGAGAGGAGTGGCTAGCAGGGGCCGCGACCCCTACTTTGACTACTGG 45 CARGVASRGRDPYFDYW :::::::::0:-1:10:11:-8:-7:19:35πŸ‘Ž51:::
3319 190 0.000114761 21 0.000124708 TGTGTGAGAGAGCTGGTCGGGTCGAGGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(795.4) IGHD6-600(27),IGHD6-1300(25),IGHD6-25*00(25) IGHJ4*00(278) nan 442|456|473|0|14|SC446TSA447GST453G|53.0 32|43|54|15|26|SC35GSA38T|27.0;20|25|63|17|22||25.0;17|22|54|17|22||25.0 28|37|68|27|36||90.0 nan TGTGTGAGAGAGCTGGTCGGGTCGAGGGACTACTGG 45 CVRELVGSRDYW :::::::::0:3:14:15:-14:7:26:27:-8:36:::
3329 190 0.000114761 22 0.000130646 TGTGCCAGAGTGCCCTTGGAGGACGACTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-30-2*00(494.2) IGHD3-300(30),IGHD3-1600(26) IGHJ4*00(387.1) IGHM*00(144.4) 445|455|476|0|10||100.0 43|49|93|15|21||30.0;52|60|111|15|23|SG56A|26.0 20|37|68|25|42||170.0 nan TGTGCCAGAGTGCCCTTGGAGGACGACTACTTTGACTACTGG 45 CARVPLEDDYFDYW :::::::::0:-1:10:15:-12:-13:21:25:0:42:::
3330 190 0.000114761 19 0.000112831 TGTGCGGCCAACTCGCCTACCTATTACTATAACAATGGTGGGTACTCTGAGGCTTTTGATGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-58*00(301.7) IGHD3-1000(51),IGHD3-2200(51) IGHJ3*00(362) nan 442|450|473|0|8||80.0 28|41|93|17|30|SG31C|51.0;28|41|93|17|30|SG31C|51.0 20|39|70|47|66|ST23GSA33G|132.0 nan TGTGCGGCCAACTCGCCTACCTATTACTATAACAATGGTGGGTACTCTGAGGCTTTTGATGTCTGG 45 CAANSPTYYYNNGGYSEAFDVW :::::::::0:-3:8:17:3:-21:30:47:0:66:::
3331 190 0.000114761 20 0.000118769 TGTGCGAGGGGTGGATACAACTATGCGGAGGGGGGCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(911.2),IGHV3-700(911.2) IGHD5-5*00(61) IGHJ4*00(194) nan 442|450|473|0|8||80.0;442|450|473|0|8||80.0 20|35|60|10|25|SG29A|61.0 30|37|68|35|42||70.0 nan TGTGCGAGGGGTGGATACAACTATGCGGAGGGGGGCTACTGG 45 CARGGYNYAEGGYW :::::::::0:-3:8:10:0:-5:25:35:-10:42:::
3332 190 0.000114761 21 0.000124708 TGTGCGAGATTATCTAGCGGCAGCTGGCCCTACTACTTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(343) IGHD6-13*00(51) IGHJ4*00(449.7) IGHA100(117),IGHA200(117) 442|451|473|0|9||90.0 26|39|63|14|27|SA30G|51.0 19|37|68|30|48|SA32C|151.0 ; TGTGCGAGATTATCTAGCGGCAGCTGGCCCTACTACTTTGACTCCTGG 45 CARLSSGSWPYYFDSW :::::::::0:-2:9:14:-5:-3:27:30:1:48:::
3333 190 0.000114761 18 0.000106892 TGTGCGAGACAGTGGCGTAATGGTTATTACCTGGGGGCCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-18*00(833.3) IGHD3-22*00(56) IGHJ4*00(307.3) nan 442|451|473|0|9||90.0 45|59|93|16|30|SG48A|56.0 30|37|68|38|45||70.0 nan TGTGCGAGACAGTGGCGTAATGGTTATTACCTGGGGGCCTACTGG 45 CARQWRNGYYLGAYW :::::::::0:-2:9:16:-14:-3:30:38:-10:45:::
3336 190 0.000114761 19 0.000112831 TGCGCGTGCGGCCCTTTTTCTTACTATGATGCCGATGGTTATTACCTCTCGGGCGGATTCTTCGAACACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(305.4) IGHD3-22*00(68) IGHJ1*00(343) nan 445|451|476|0|6|ST447C|31.0 34|59|93|20|45|DA44ST46CSA47CI49A|68.0 25|41|72|56|72|SA27TSC32GSG34A|73.0 nan TGCGCGTGCGGCCCTTTTTCTTACTATGATGCCGATGGTTATTACCTCTCGGGCGGATTCTTCGAACACTGG 45 CACGPFSYYDADGYYLSGGFFEHW :::::::::0:-5:6:20:-3:-3:45:56:-5:72:::
3351 189 0.000114157 19 0.000112831 TGTGCGAGACAGACCCTTCCTGGGGCCACCGGCGTGGCAGTGGCTGGTCTTGACTCTTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(487.9) IGHD6-19*00(60) IGHJ4*00(322.8) IGHA100(66.1),IGHA200(66.1) 445|456|476|0|11||110.0 28|40|63|36|48||60.0 26|37|68|49|60|SA32CSC33T|52.0 ; TGTGCGAGACAGACCCTTCCTGGGGCCACCGGCGTGGCAGTGGCTGGTCTTGACTCTTGG 45 CARQTLPGATGVAVAGLDSW :::::::::0:0:11:36:-7:-2:48:49:-6:60:::
3354 189 0.000114157 17 0.000100954 TGTAGTAGAGATGTCGTCAGAAGTCATGATGCTTTCGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-49*00(499.2) nan IGHJ3*00(449.3) IGHG100(133.7),IGHG200(133.7),IGHG400(133.7),IGHGP00(133.7) 448|463|479|0|15|SC452GSC460G|92.0 nan 17|39|70|23|45|ST29C|191.0 ;;; TGTAGTAGAGATGTCGTCAGAAGTCATGATGCTTTCGATATCTGG 45 CSRDVVRSHDAFDIW :::::::::0:4:15:::::23:3:45:::
3368 188 0.000113553 17 0.000100954 TGTGCGAGATCTATAGTATTGGCTGGGTTCTTTGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(453) IGHD6-19*00(47) IGHJ4*00(374.4) IGHA100(157.4),IGHA200(157.4) 445|454|476|0|9||90.0 24|39|63|11|26|SC29TSG31T|47.0 24|37|68|29|42|SA32T|101.0 ; TGTGCGAGATCTATAGTATTGGCTGGGTTCTTTGACTTCTGG 45 CARSIVLAGFFDFW :::::::::0:-2:9:11:-3:-3:26:29:-4:42:::
3369 188 0.000113553 15 8.90768e-05 TGTGCGAAACGGATCTGTAGTAGTACCAGCTGCCGACCGTACTACTTTGCCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(499.3) IGHD2-2*00(90) IGHJ4*00(469.2) IGHM*00(74.6) 442|451|473|0|9||90.0 38|56|93|15|33||90.0 18|37|68|38|57|SA29C|161.0 nan TGTGCGAAACGGATCTGTAGTAGTACCAGCTGCCGACCGTACTACTTTGCCTACTGG 45 CAKRICSSTSCRPYYFAYW :::::::::0:-2:9:15:-7:-6:33:38:2:57:::
3395 187 0.000112949 14 8.31384e-05 TGTGCGGCCCGGGAAGACTACGGTAACAACGATGGTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-69D*00(525.8) IGHD4-1100(47),IGHD4-1700(47),IGHD4-4*00(47) IGHJ3*00(302.3) nan 442|448|473|0|6||60.0 17|32|48|15|30|SA23GST29A|47.0;17|32|48|15|30|SG26AST29A|47.0;17|32|48|15|30|SA23GST29A|47.0 21|39|70|30|48|SC25G|151.0 nan TGTGCGGCCCGGGAAGACTACGGTAACAACGATGGTTTTGATATCTGG 45 CAAREDYGNNDGFDIW :::::::::0:-5:6:15πŸ‘Ž0:30:30πŸ‘Ž48:::
3396 187 0.000112949 23 0.000136584 TGTGCGAAAGCCCCCGGGGACTACTATTACTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(907.9) IGHD6-1300(30),IGHD6-1900(30),IGHD6-25*00(30) IGHJ6*00(205.5) nan 442|452|473|0|10||100.0 18|24|63|12|18||30.0;18|24|63|12|18||30.0;15|21|54|12|18||30.0 23|52|83|19|45|SC30TDG37DG38DT39|147.0 nan TGTGCGAAAGCCCCCGGGGACTACTATTACTACATGGACGTCTGG 45 CAKAPGDYYYYMDVW :::::::::0:-1:10:12:3:-18:18:19:-3:45:::
3405 186 0.000112345 16 9.50153e-05 TGTCATGGTTGGGGGATCTGG NNNNNNNNNNNNNNNNNNNNN IGHV3-66*00(687.9) IGHD3-16*00(40) IGHJ500(340.8),IGHJ400(340.2) nan 439|442|470|0|3||30.0 52|60|111|8|16||40.0 36|40|71|17|21||40.0;33|37|68|17|21||40.0 nan TGTCATGGTTGGGGGATCTGG 45 CHGWGIW :::::::::0:-8:3:8:-15:-14:16:17:-16:21:::
3415 186 0.000112345 17 0.000100954 TGTGCCCGGGCGGGAGGGAAATACCATACCGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-2*00(725.4) IGHD2-800(31),IGHD3-1000(30),IGHD5-5*00(30) IGHJ4*00(333.4) nan 442|447|473|0|5||50.0 3|12|93|20|29|SG6C|31.0;18|24|93|22|28||30.0;3|9|60|22|28||30.0 28|37|68|30|39||90.0 nan TGTGCCCGGGCGGGAGGGAAATACCATACCGACTACTGG 45 CARAGGKYHTDYW :::::::::0:-6:5:20:28:-50:29:30:-8:39:::
3417 186 0.000112345 18 0.000106892 TGTGCGAGACTCTCTCGTTGTAGTGGTGATAACTGCCACCCCCTCGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(456.6) IGHD2-15*00(69) IGHJ6*00(318.3) IGHG100(113.7),IGHG200(113.7),IGHG400(113.7),IGHGP00(113.7) 445|455|476|0|10||100.0 37|62|93|17|42|SG48ASG51AST56CST59C|69.0 45|52|83|44|51||70.0 ;;; TGTGCGAGACTCTCTCGTTGTAGTGGTGATAACTGCCACCCCCTCGTCTGG 45 CARLSRCSGDNCHPLVW :::::::::0:-1:10:17:-6:0:42:44:-25:51:::
3418 186 0.000112345 19 0.000112831 TGTGCGAAAGGTCGGGATAGTAGTGGTTCCCGCGGCGGGGGATTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(481.2) IGHD3-22*00(65) IGHJ4*00(428) IGHM*00(88.1) 442|455|473|0|13|SA452G|101.0 41|54|93|15|28||65.0 25|37|68|42|54||120.0 nan TGTGCGAAAGGTCGGGATAGTAGTGGTTCCCGCGGCGGGGGATTTGACTACTGG 45 CAKGRDSSGSRGGGFDYW :::::::::0:2:13:15:-10:-8:28:42:-5:54:::
3432 185 0.000111741 20 0.000118769 TGTGTTAGAGATCTCGTCGGGCCGAGGGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(886.7) IGHD6-6*00(27) IGHJ5*00(201.6) nan 442|457|473|0|15|SC446TSA447T|92.0 32|43|54|15|26|SC35GSA38C|27.0 31|40|71|27|36|SC34T|61.0 nan TGTGTTAGAGATCTCGTCGGGCCGAGGGACTCCTGG 45 CVRDLVGPRDSW :::::::::0:4:15:15:-14:7:26:27:-11:36:::
3437 185 0.000111741 23 0.000136584 TGTGCGACTAACAGTGTACAAGTGGCGGGTAGTTGGGCTTTTGATGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(816.6) IGHD6-1900(41),IGHD1-100(36) IGHJ3*00(159.8) nan 442|449|473|0|7||70.0 30|41|63|20|31|ST36G|41.0;18|28|51|15|25|SC24G|36.0 24|39|70|36|51|SA33G|121.0 nan TGTGCGACTAACAGTGTACAAGTGGCGGGTAGTTGGGCTTTTGATGTCTGG 45 CATNSVQVAGSWAFDVW :::::::::0:-4:7:20:-9:-1:31:36:-4:51:::
3438 185 0.000111741 18 0.000106892 TGTGCGAGACTTAGCACAGTGCAAGAGGCTTTGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-5900(803.7),IGHV4-6100(803.7) IGHD6-1300(28),IGHD2-800(26),IGHD6-25*00(25) IGHJ4*00(218.9) nan 439|448|470|0|9||90.0;445|454|476|0|9||90.0 26|35|63|11|19|DG31|28.0;17|25|93|16|24|SA21G|26.0;23|28|54|11|16||25.0 25|37|68|30|42|ST27G|91.0 nan TGTGCGAGACTTAGCACAGTGCAAGAGGCTTTGGACTACTGG 45 CARLSTVQEALDYW :::::::::0:-2:9:11:-5:-7:19:30:-5:42:::
3439 185 0.000111741 19 0.000112831 TGTGCGAGAGATGGTCAGGACAACGGTGGCTACGGACGTTTTGACTATTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-46*00(725.5) IGHD4-17*00(63) IGHJ4*00(216.5) nan 442|454|473|0|12||120.0 12|33|48|13|34|ST16GST20ASA27G|63.0 25|37|68|39|51|SC33T|91.0 nan TGTGCGAGAGATGGTCAGGACAACGGTGGCTACGGACGTTTTGACTATTGG 45 CARDGQDNGGYGRFDYW :::::::::0:1:12:13:4:1:34:39:-5:51:::
3440 185 0.000111741 18 0.000106892 TGTGCGAAATTAGGGCAGCAGCTGGAAGTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(295.6) IGHD6-13*00(55) IGHJ4*00(401.7) IGHM*00(158.5) 442|451|473|0|9||90.0 28|39|63|14|25||55.0 26|37|68|28|39||110.0 nan TGTGCGAAATTAGGGCAGCAGCTGGAAGTTGACTACTGG 45 CAKLGQQLEVDYW :::::::::0:-2:9:14:-7:-3:25:28:-6:39:::
3441 185 0.000111741 20 0.000118769 TGTGCGAAATCGGCAATCCTCCAGAGTTTGTGGTCTTTGTGGGGGGGGGATTACTACTTTGACTCATGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-53*00(299.1) IGHD4-2300(36),IGHD2-2100(35),IGHD2-15*00(31) IGHJ4*00(356.9) nan 439|446|470|0|7||70.0 34|44|57|18|28|SG38A|36.0;34|41|84|27|34||35.0;58|67|93|18|27|SG62A|31.0 19|37|68|51|69|SA32CSC33A|122.0 nan TGTGCGAAATCGGCAATCCTCCAGAGTTTGTGGTCTTTGTGGGGGGGGGATTACTACTTTGACTCATGG 45 CAKSAILQSLWSLWGGDYYFDSW :::::::::0:-4:7:18:-15:6:28:51:1:69:::
3458 184 0.000111137 20 0.000118769 TGTGCGAGCGGCGGACCCACAGTGGCTGGTAGGGCGATAGACTGGTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-2*00(774.2) IGHD6-19*00(60) IGHJ400(158.7),IGHJ500(156.9) nan 442|450|473|0|8||80.0 29|41|63|19|31||60.0 28|37|68|39|48|SA32GSC33G|32.0;37|40|71|45|48||30.0 nan TGTGCGAGCGGCGGACCCACAGTGGCTGGTAGGGCGATAGACTGGTGG 45 CASGGPTVAGRAIDWW :::::::::0:-3:8:19:-8:-1:31:39:-8:48:::
3459 184 0.000111137 17 0.000100954 TGTGCGAGAGGGTATGGCAGTGGCTGGTTTGATTTCGGTTTCGACATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-400(314.3),IGHV4-5500(307.2) IGHD6-19*00(76) IGHJ3*00(321.4) IGHA100(111.7),IGHA200(111.7) 442|452|473|0|10||100.0;442|451|473|0|9||90.0 22|40|63|10|28|SA27G|76.0 26|39|70|38|51|ST29CST32C|72.0 ; TGTGCGAGAGGGTATGGCAGTGGCTGGTTTGATTTCGGTTTCGACATCTGG 45 CARGYGSGWFDFGFDIW :::::::::0:-1:10:10πŸ‘Ž-2:28:38:-6:51:::
3460 184 0.000111137 20 0.000118769 TGTGCGAGAGACACCACTACACTAGGATATTGTGGTAGTACAAGTTGCTATCACTCCTTGGCTTTTGGTGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(395.8) IGHD2-2*00(108) IGHJ3*00(340.2) nan 442|453|473|0|11||110.0 29|59|93|21|51|SA41GSC49ASC52T|108.0 24|39|70|60|75|SA31GSA33G|92.0 nan TGTGCGAGAGACACCACTACACTAGGATATTGTGGTAGTACAAGTTGCTATCACTCCTTGGCTTTTGGTGTCTGG 45 CARDTTTLGYCGSTSCYHSLAFGVW :::::::::0:0:11:21:2:-3:51:60:-4:75:::
3461 184 0.000111137 18 0.000106892 TGTGCGAGAGAAACAGTACCAGCTGTCAGAGGTGCTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-18*00(838.6) IGHD2-200(55),IGHD6-1300(50) IGHJ3*00(359.1) nan 442|453|473|0|11||110.0 44|55|93|14|25||55.0;0|10|63|15|25||50.0 23|39|70|32|48||160.0 nan TGTGCGAGAGAAACAGTACCAGCTGTCAGAGGTGCTTTTGATATCTGG 45 CARETVPAVRGAFDIW :::::::::0:0:11:14:-13:-7:25:32:-3:48:::
3462 184 0.000111137 21 0.000124708 TGTGCGAAAGATCTCCCATACCAGACAGCTGGTCCGTCCCACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(943.3) IGHD6-13*00(56) IGHJ4*00(150.1) nan 442|456|473|0|14||140.0 25|47|63|17|40|SG28CI32ASA40CSA44C|56.0 23|37|68|40|54||140.0 nan TGTGCGAAAGATCTCCCATACCAGACAGCTGGTCCGTCCCACTTTGACTACTGG 45 CAKDLPYQTAGPSHFDYW :::::::::0:3:14:17:-4:5:40:40:-3:54:::
3465 184 0.000111137 19 0.000112831 TGTGGAAGAGGCGGGTATGGTTCGGGTGATAACTGGCTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(951.8) IGHD3-1000(43),IGHD1-1400(37) IGHJ5*00(216.7) nan 442|452|473|0|10|SC446G|71.0 38|50|93|15|26|DA46|43.0;1|14|51|17|30|SC7GST11G|37.0 22|40|71|30|48|ST28C|151.0 nan TGTGGAAGAGGCGGGTATGGTTCGGGTGATAACTGGCTCGACCCCTGG 45 CGRGGYGSGDNWLDPW :::::::::0:-1:10:15:-7:-12:26:30:-2:48:::
3488 183 0.000110533 19 0.000112831 TGTGCGCGAGCCCCCCAGAAGTGGGAGATGCTTATTCGCTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-69D*00(652.2) IGHD1-2600(40),IGHD3-300(34) IGHJ6*00(191.9) nan 442|452|473|0|10|SA448C|71.0 25|33|60|19|27||40.0;45|57|93|23|36|I49ASG51C|34.0 40|52|83|42|54||120.0 nan TGTGCGCGAGCCCCCCAGAAGTGGGAGATGCTTATTCGCTACATGGACGTCTGG 45 CARAPQKWEMLIRYMDVW :::::::::0:-1:10:19:-5:-7:27:42:-20:54:::
3489 183 0.000110533 13 7.71999e-05 TGTGCGAGAATCAATTATTATGGTTCGAGGAGTCCCCCGTACTTCTTCGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-18*00(658) IGHD3-10*00(58) IGHJ4*00(315.7) nan 442|451|473|0|9||90.0 33|53|93|13|33|SC37TSA46GSG47A|58.0 18|37|68|38|57|SA23TST27C|132.0 nan TGTGCGAGAATCAATTATTATGGTTCGAGGAGTCCCCCGTACTTCTTCGACTACTGG 45 CARINYYGSRSPPYFFDYW :::::::::0:-2:9:13:-2:-9:33:38:2:57:::
3490 183 0.000110533 16 9.50153e-05 TGTGCGAGAAGGGTTGTAAGTGGCTGGTACGACTACTTTGATTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-18*00(740) IGHD6-19*00(65) IGHJ4*00(387.2) nan 442|451|473|0|9||90.0 30|43|63|18|31||65.0 20|37|68|31|48|SC30T|141.0 nan TGTGCGAGAAGGGTTGTAAGTGGCTGGTACGACTACTTTGATTACTGG 45 CARRVVSGWYDYFDYW :::::::::0:-2:9:18:-9:1:31:31:0:48:::
3491 183 0.000110533 18 0.000106892 TGTGCGAAAAGCCTATACGGTGGTAACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(462.3) IGHD4-23*00(50) IGHJ4*00(345.5) IGHA1*00(190.3) 442|451|473|0|9||90.0 23|33|57|15|25||50.0 29|37|68|25|33|SA32T|51.0 nan TGTGCGAAAAGCCTATACGGTGGTAACTTCTGG 45 CAKSLYGGNFW :::::::::0:-2:9:15:-4:-5:25:25:-9:33:::
3495 183 0.000110533 23 0.000136584 TGCGCGAGAGTTGCGCTCGCCGATCGCAGTGCCTGGAACCAAGGATACAATTACTACGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-400(390.5),IGHV4-5500(382.1) IGHD6-19*00(43) IGHJ6*00(411) nan 442|452|473|0|10|ST444C|71.0;442|451|473|0|9|ST444C|61.0 25|42|63|22|39|SA27CSG34CST39A|43.0 25|52|83|45|72|ST28ASC30T|212.0 nan TGCGCGAGAGTTGCGCTCGCCGATCGCAGTGCCTGGAACCAAGGATACAATTACTACGGTATGGACGTCTGG 45 CARVALADRSAWNQGYNYYGMDVW :::::::::0:-1:10:22:-4:0:39:45:-5:72:::
3513 182 0.000109929 17 0.000100954 TGTGCTAGATCCCCTGATAGTAGTGCCTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-72*00(547.8) IGHD3-22*00(55) IGHJ4*00(398.2) IGHM*00(152.5) 448|457|479|0|9||90.0 40|51|93|14|25||55.0 24|37|68|26|39||130.0 nan TGTGCTAGATCCCCTGATAGTAGTGCCTTTGACTACTGG 45 CARSPDSSAFDYW :::::::::0:-2:9:14:-9:-11:25:26:-4:39:::
3519 182 0.000109929 12 7.12614e-05 TGTGCGAGAGGTCTTAGTGACTGGCCGCCTTACTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-18*00(763.3) IGHD3-900(35),IGHD4-1100(31),IGHD6-19*00(31) IGHJ4*00(466.4) nan 442|456|473|0|14|SA452G|111.0 45|52|93|17|24||35.0;1|10|48|14|23|ST5G|31.0;30|39|63|15|24|SG34A|31.0 19|37|68|30|48||180.0 nan TGTGCGAGAGGTCTTAGTGACTGGCCGCCTTACTACTTTGACTACTGG 45 CARGLSDWPPYYFDYW :::::::::0:3:14:17:-14:-10:24:30:1:48:::
3520 182 0.000109929 19 0.000112831 TGTGGGAGATGGCTTGGCGCCCCGGGATACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(787.3) IGHD5-2400(35),IGHD6-1300(30),IGHD6-25*00(30) IGHJ4*00(211.6) nan 442|449|473|0|7|SC446G|41.0 25|32|60|7|14||35.0;18|24|63|20|26||30.0;15|21|54|20|26||30.0 31|37|68|27|33||60.0 nan TGTGGGAGATGGCTTGGCGCCCCGGGATACTGG 45 CGRWLGAPGYW :::::::::0:-4:7:7:-5:-8:14:27:-11:33:::
3539 181 0.000109325 20 0.000118769 TGTGCGAGACTGCGAGTGACCCAACCCCGGCCCTCCTTTTATTACTTTTACGGTTTCGATGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(485) IGHD4-2300(26),IGHD6-1300(25),IGHD6-25*00(25) IGHJ6*00(339.4) IGHA100(40),IGHA200(40) 442|452|473|0|10||100.0 1|9|57|13|21|ST5G|26.0;18|23|63|25|30||25.0;15|20|54|25|30||25.0 25|52|83|39|66|SC27TSA32TSC33TSA40TSG42CSC45T|96.0 ; TGTGCGAGACTGCGAGTGACCCAACCCCGGCCCTCCTTTTATTACTTTTACGGTTTCGATGTCTGG 45 CARLRVTQPRPSFYYFYGFDVW :::::::::0:-1:10:13:18:-29:21:39:-5:66:::
3540 181 0.000109325 21 0.000124708 TGTGCGAGAGATTCTGCGTTGAAAGCTATAGGGGACTCGTTTGATTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(852.2),IGHV3-700(852.2) IGHD1-2600(33),IGHD6-1300(30),IGHD6-25*00(30) IGHJ4*00(151.3) nan 442|454|473|0|12||120.0;442|454|473|0|12||120.0 22|32|60|26|35|DT27|33.0;12|18|63|24|30||30.0;9|15|54|24|30||30.0 25|37|68|39|51|SC30T|91.0 nan TGTGCGAGAGATTCTGCGTTGAAAGCTATAGGGGACTCGTTTGATTACTGG 45 CARDSALKAIGDSFDYW :::::::::0:1:12:26:-2:-8:35:39:-5:51:::
3562 180 0.000108721 20 0.000118769 TGTGTAAAAGATTTGAGTCCAGGGGGAGCGGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-9*00(912.2) IGHD3-1600(35),IGHD1-2600(31) IGHJ5*00(161.5) nan 442|454|475|0|12|SC446T|91.0 54|61|111|21|28||35.0;25|34|60|20|29|ST27G|31.0 31|40|71|30|39|SC34T|61.0 nan TGTGTAAAAGATTTGAGTCCAGGGGGAGCGGACTCCTGG 45 CVKDLSPGGADSW :::::::::0:-1:12:21:-17:-13:28:30:-11:39:::
3566 180 0.000108721 23 0.000136584 TGTGCGCGAGCCCCCCAGAGGTGGGAGATGCTTATTATCCAGATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-69D*00(761.3) IGHD3-300(44),IGHD2-1500(38) IGHJ6*00(187.2) nan 442|452|473|0|10|SA448C|71.0 45|59|93|23|38|I49ASG51C|44.0;41|57|93|16|32|ST43AST49GSC52A|38.0 40|52|83|42|54||120.0 nan TGTGCGCGAGCCCCCCAGAGGTGGGAGATGCTTATTATCCAGATGGACGTCTGG 45 CARAPQRWEMLIIQMDVW :::::::::0:-1:10:23:-14:-3:38:42:-20:54:::
3567 180 0.000108721 17 0.000100954 TGTGCGAAAGGAAGAGACTCCGGTGGTAACATCCTTGACTTGTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-66*00(772.6) IGHD4-23*00(64) IGHJ4*00(152) nan 439|449|470|0|10|SG446A|71.0 20|38|57|15|34|SA24CI35A|64.0 26|37|68|34|45|SA32TSC33G|52.0 nan TGTGCGAAAGGAAGAGACTCCGGTGGTAACATCCTTGACTTGTGG 45 CAKGRDSGGNILDLW :::::::::0:-1:10:15πŸ‘Ž0:34:34:-6:45:::
3572 180 0.000108721 19 0.000112831 TGTGGAAGAGATACGGGCGGTTCGGGGGGCCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(905.1) IGHD3-10*00(31) IGHJ5*00(222.6) nan 442|454|473|0|12|SC446G|91.0 41|50|93|18|27|SA46G|31.0 33|40|71|29|36|SC35T|41.0 nan TGTGGAAGAGATACGGGCGGTTCGGGGGGCCTCTGG 45 CGRDTGGSGGLW :::::::::0:1:12:18:-10:-12:27:29:-13:36:::
3573 180 0.000108721 16 9.50153e-05 TGTACCACGTGGACTACGGTGGTGACCCTTTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-15*00(481.2) IGHD4-23*00(61) IGHJ400(328.2),IGHJ500(328.2) IGHA2*00(191.4) 448|456|479|0|8||80.0 20|35|57|11|26|SA32G|61.0 34|37|68|30|33||30.0;37|40|71|30|33||30.0 nan TGTACCACGTGGACTACGGTGGTGACCCTTTGG 45 CTTWTTVVTLW :::::::::0:-3:8:11πŸ‘Ž-3:26:30:-14:33:::
3575 180 0.000108721 20 0.000118769 TGCGCGAGAGGCGTCCAGACACTAACTACTACGGGGCAAGTAATTGCATACTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-2*00(553) IGHD4-1100(41),IGHD4-400(41),IGHD1-26*00(40) IGHJ6*00(363.9) nan 442|452|473|0|10|ST444C|71.0 21|32|48|18|29|SG24C|41.0;21|32|48|18|29|SG24C|41.0;33|41|60|25|33||40.0 40|52|83|54|66||120.0 nan TGCGCGAGAGGCGTCCAGACACTAACTACTACGGGGCAAGTAATTGCATACTACATGGACGTCTGG 45 CARGVQTLTTTGQVIAYYMDVW :::::::::0:-1:10:18:-5:0:29:54:-20:66:::
3591 179 0.000108117 16 9.50153e-05 TGTGTGAGAGATATAGCAGGAGGTGGACTTTATAACTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(350.2) IGHD6-13*00(42) IGHJ5*00(441.6) IGHG100(111.7),IGHG200(111.7),IGHG400(111.7),IGHGP00(111.7) 445|457|476|0|12|SC449TSC454G|62.0 25|39|63|12|26|SC32GSC35G|42.0 19|40|71|30|51|SC21T|181.0 ;;; TGTGTGAGAGATATAGCAGGAGGTGGACTTTATAACTGGTTCGACCCCTGG 45 CVRDIAGGGLYNWFDPW :::::::::0:1:12:12:-4:-3:26:30:1:51:::
3595 179 0.000108117 20 0.000118769 TGTGCGCGAGTTGAAGAAAGTGGTTACTATGATCCTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-33*00(758.2) IGHD3-2200(50),IGHD3-300(46) IGHJ4*00(195.3) nan 442|452|473|0|10|SA448C|71.0 34|44|93|23|33||50.0;47|59|93|18|30|ST55C|46.0 27|37|68|35|45||100.0 nan TGTGCGCGAGTTGAAGAAAGTGGTTACTATGATCCTGACTACTGG 45 CARVEESGYYDPDYW :::::::::0:-1:10:23:-3:-18:33:35:-7:45:::
3596 179 0.000108117 17 0.000100954 TGTGCGGGGTATAGTGGGAGCTACTACAACTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-33*00(740.9) IGHD1-26*00(85) IGHJ5*00(303.3) nan 442|448|473|0|6||60.0 20|37|60|7|24||85.0 19|40|71|24|45||210.0 nan TGTGCGGGGTATAGTGGGAGCTACTACAACTGGTTCGACCCCTGG 45 CAGYSGSYYNWFDPW :::::::::0:-5:6:7:0:-3:24:24:1:45:::
3597 179 0.000108117 17 0.000100954 TGTGCGAGCACTGATGGTTACCCAAACTGGTTCGTCCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(284.7) IGHD5-5*00(40) IGHJ5*00(397.1) IGHG100(154.8),IGHG200(154.8),IGHG400(154.8),IGHGP00(154.8) 445|453|476|0|8||80.0 32|40|60|13|21||40.0 22|40|71|24|42|SA32T|151.0 ;;; TGTGCGAGCACTGATGGTTACCCAAACTGGTTCGTCCCCTGG 45 CASTDGYPNWFVPW :::::::::0:-3:8:13:-12:0:21:24:-2:42:::
3598 179 0.000108117 18 0.000106892 TGTGCGAGACGGAATCCACATTGTGGTGGTGACTGTTACCACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(511.7) IGHD2-21*00(67) IGHJ4*00(455.8) IGHA100(96.2),IGHA200(96.2) 442|452|473|0|10||100.0 30|49|84|16|35|ST32CST46C|67.0 19|37|68|36|54|ST22C|151.0 ; TGTGCGAGACGGAATCCACATTGTGGTGGTGACTGTTACCACTTTGACTACTGG 45 CARRNPHCGGDCYHFDYW :::::::::0:-1:10:16:-2:-7:35:36:1:54:::
3600 179 0.000108117 18 0.000106892 TGTACAAGAGATATAGGTGGTCGCGCGGGCTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(881.3) IGHD2-1500(31),IGHD2-2100(30),IGHD4-23*00(30) IGHJ4*00(216.6) nan 442|454|473|0|12|SG445A|91.0 44|53|93|15|24|SA50C|31.0;38|44|84|15|21||30.0;26|32|57|15|21||30.0 30|37|68|29|36|SA32T|41.0 nan TGTACAAGAGATATAGGTGGTCGCGCGGGCTTCTGG 45 CTRDIGGRAGFW :::::::::0:1:12:15:-13:-9:24:29:-10:36:::
3626 178 0.000107513 16 9.50153e-05 TGTGCGCAAGAGATCCGGCCGAATGACCGCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(582.9) IGHD6-6*00(31) IGHJ5*00(263.9) nan 442|453|473|0|11|SA448C|81.0 33|42|54|13|22|SA38C|31.0 31|40|71|24|33|SC35G|61.0 nan TGTGCGCAAGAGATCCGGCCGAATGACCGCTGG 45 CAQEIRPNDRW :::::::::0:0:11:13:-15:6:22:24:-11:33:::
3627 178 0.000107513 18 0.000106892 TGTGCGAGAGAGGAGAATCCCCAATATTGTAGTGGAGATCGCTGCAAGACAGGGGCCTTTTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(322.3) IGHD2-1500(68),IGHD2-2100(58) IGHJ4*00(382.2) nan 445|454|476|0|9||90.0 34|56|93|23|45|ST46ASG48ASA50C|68.0;31|51|84|23|43|SG38AST43AST47C|58.0 25|37|68|60|72||120.0 nan TGTGCGAGAGAGGAGAATCCCCAATATTGTAGTGGAGATCGCTGCAAGACAGGGGCCTTTTTTGACTACTGG 45 CAREENPQYCSGDRCKTGAFFDYW :::::::::0:-2:9:23:-3:-6:45:60:-5:72:::
3628 178 0.000107513 18 0.000106892 TGTGCGAAAGGGATCAGTTACTACCACGGCTTGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(988.2) IGHD7-27*00(25) IGHJ6*00(263) nan 442|452|473|0|10||100.0 19|24|33|10|15||25.0 28|52|83|18|42|ST34CST39CSA40T|153.0 nan TGTGCGAAAGGGATCAGTTACTACCACGGCTTGGACGTCTGG 45 CAKGISYYHGLDVW :::::::::0:-1:10:10:-8:2:15:18:-8:42:::
3630 178 0.000107513 19 0.000112831 TGTACCACGTGGACTACGGTGGTGACCCTTTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-15*00(836.5) IGHD4-23*00(61) IGHJ400(267.6),IGHJ500(267.6) nan 448|456|479|0|8||80.0 20|35|57|11|26|SA32G|61.0 34|37|68|30|33||30.0;37|40|71|30|33||30.0 nan TGTACCACGTGGACTACGGTGGTGACCCTTTGG 45 CTTWTTVVTLW :::::::::0:-3:8:11πŸ‘Ž-3:26:30:-14:33:::
3653 177 0.000106909 19 0.000112831 TGTGCGGGACCCGGGACTACTGGCCTGGCCACTTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(675.6) IGHD1-100(37),IGHD1-2600(33),IGHD4-17*00(33) IGHJ400(207.1),IGHJ500(207.1) nan 442|452|473|0|10|SA448G|71.0 15|28|51|10|23|ST19GSA22T|37.0;28|38|60|12|21|DG32|33.0;22|32|48|11|20|DT25|33.0 34|37|68|33|36||30.0;37|40|71|33|36||30.0 nan TGTGCGGGACCCGGGACTACTGGCCTGGCCACTTGG 45 CAGPGTTGLATW :::::::::0:-1:10:10:2:-6:23:33:-14:36:::
3654 177 0.000106909 16 9.50153e-05 TGTGCGAGAGAGAGGGGGAGACTCGTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-5900(424.3),IGHV4-6100(424.3) IGHD3-16*00(35) IGHJ4*00(371.6) IGHM*00(177.5) 439|450|470|0|11||110.0;445|456|476|0|11||110.0 54|61|111|13|20||35.0 26|37|68|25|36||110.0 nan TGTGCGAGAGAGAGGGGGAGACTCGTTGACTACTGG 45 CARERGRLVDYW :::::::::0:0:11:13:-17:-13:20:25:-6:36:::
3676 176 0.000106305 17 0.000100954 TGTGTGAAAACGGGGTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(848.7) nan IGHJ4*00(349.1) nan 442|451|473|0|9|SC446T|61.0 nan 25|37|68|15|27||120.0 nan TGTGTGAAAACGGGGTTTGACTACTGG 45 CVKTGFDYW :::::::::0:-2:9:::::15:-5:27:::
3680 176 0.000106305 18 0.000106892 TGTGCCAGAGAGGGGGACTTTAGCAGCTCTTCTCCCGATGCTCTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(854.9),IGHV3-700(854.9) IGHD6-600(46),IGHD2-1500(40),IGHD2-2*00(40) IGHJ3*00(161.1) nan 442|453|473|0|11|SG447C|81.0;442|453|473|0|11|SG447C|81.0 23|35|54|20|32|SG32T|46.0;4|12|93|20|28||40.0;4|12|93|20|28||40.0 21|39|70|36|54|ST27C|151.0 nan TGTGCCAGAGAGGGGGACTTTAGCAGCTCTTCTCCCGATGCTCTTGATATCTGG 45 CAREGDFSSSSPDALDIW :::::::::0:0:11:20:-5:-1:32:36πŸ‘Ž54:::
3681 176 0.000106305 14 8.31384e-05 TGTGCGGGCCGCAATACCAGCACATGGTACTCAGATTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-11*00(313.4) IGHD2-2100(44),IGHD6-1300(43) IGHJ4*00(391.2) IGHA100(117.6),IGHA200(117.6) 442|448|473|0|6||60.0 6|21|84|10|24|DC11SC16G|44.0;25|42|63|13|30|SG28CSG34CSC35A|43.0 25|37|68|36|48||120.0 ; TGTGCGGGCCGCAATACCAGCACATGGTACTCAGATTTTGACTACTGG 45 CAGRNTSTWYSDFDYW :::::::::0:-5:6:10:22:-35:24:36:-5:48:::
3682 176 0.000106305 20 0.000118769 TGTGCGAGACTACCGAGGGACTACCACGGAATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-46*00(334.1) IGHD1-700(25),IGHD2-1500(25),IGHD3-3*00(25) IGHJ6*00(409.3) IGHA100(97.1),IGHA200(97.1) 442|451|473|0|9||90.0 13|18|51|10|15||25.0;10|15|93|9|14||25.0;58|63|93|10|15||25.0 29|52|83|19|42|ST34CST39A|172.0 ; TGTGCGAGACTACCGAGGGACTACCACGGAATGGACGTCTGG 45 CARLPRDYHGMDVW :::::::::0:-2:9:10:4:-16:15:19:-9:42:::
3683 176 0.000106305 15 8.90768e-05 TGTGCGAGACGAGGAAGTACTGCCTTCTCCCCCGAGGGCGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-18*00(720.8) IGHD3-1600(35),IGHD2-800(30) IGHJ4*00(309.5) nan 442|451|473|0|9||90.0 13|20|111|26|33||35.0;39|45|93|16|22||30.0 28|37|68|39|48||90.0 nan TGTGCGAGACGAGGAAGTACTGCCTTCTCCCCCGAGGGCGACTACTGG 45 CARRGSTAFSPEGDYW :::::::::0:-2:9:26:24:-54:33:39:-8:48:::
3684 176 0.000106305 20 0.000118769 TGTGCGAGAATAGCTGTGGCTGACAGGGGGTTCGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(240.8) IGHD6-19*00(51) IGHJ5*00(340.7) IGHA100(149.1),IGHA200(149.1) 442|451|473|0|9||90.0 25|38|63|9|22|SA30T|51.0 26|40|71|28|42|SC34TSC35T|82.0 ; TGTGCGAGAATAGCTGTGGCTGACAGGGGGTTCGACTTCTGG 45 CARIAVADRGFDFW :::::::::0:-2:9:9:-4:-4:22:28:-6:42:::
3685 176 0.000106305 18 0.000106892 TGTGCGAAAGGTCAGATGAGGGCGGTGACTCTACGAGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-30*00(1020.4) IGHD4-1700(40),IGHD5-2400(35) IGHJ6*00(185.7) nan 442|455|473|0|13|SA452G|101.0 22|30|48|22|30||40.0;14|21|60|28|35||35.0 37|52|83|36|51||150.0 nan TGTGCGAAAGGTCAGATGAGGGCGGTGACTCTACGAGGTATGGACGTCTGG 45 CAKGQMRAVTLRGMDVW :::::::::0:2:13:22:-6:-2:30:36:-17:51:::
3686 176 0.000106305 15 8.90768e-05 TGTGCACGGACGAGATATAGCACTGGCTTGTACTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-70*00(463) IGHD6-19*00(51) IGHJ4*00(465.9) IGHG100(128.6),IGHG200(128.6),IGHG400(128.6),IGHGP00(128.6) 445|455|478|0|10||100.0 24|37|63|15|28|SG31C|51.0 18|37|68|29|48||190.0 ;;; TGTGCACGGACGAGATATAGCACTGGCTTGTACTACTTTGACTACTGG 45 CARTRYSTGLYYFDYW :::::::::0:-3:10:15:-3:-5:28:29:2:48:::
3708 175 0.000105701 18 0.000106892 TGTGCCAGAAGTGGAGCCGATTCCGCGGGCGTAGTGGTCCTCCTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-46*00(617.9) IGHD2-1500(40),IGHD3-2200(40) IGHJ4*00(206.7) nan 442|451|473|0|9|SG447C|61.0 39|47|93|30|38||40.0;45|53|93|30|38||40.0 26|37|68|43|54||110.0 nan TGTGCCAGAAGTGGAGCCGATTCCGCGGGCGTAGTGGTCCTCCTTGACTACTGG 45 CARSGADSAGVVVLLDYW :::::::::0:-2:9:30:-8:-15:38:43:-6:54:::
3709 175 0.000105701 18 0.000106892 TGTGCGACCACGTATTACTATGGTGGTTTTGATATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(850.3),IGHV3-700(850.3) IGHD3-1000(50),IGHD3-2200(50),IGHD3-3*00(45) IGHJ3*00(299) nan 442|449|473|0|7||70.0;442|449|473|0|7||70.0 29|39|93|9|19||50.0;29|39|93|9|19||50.0;29|38|93|9|18||45.0 19|39|70|19|39|SA22GSC25G|142.0 nan TGTGCGACCACGTATTACTATGGTGGTTTTGATATCTGG 45 CATTYYYGGFDIW :::::::::0:-4:7:9:2:-23:19:19:1:39:::
3710 175 0.000105701 17 0.000100954 TGTGCGAGGGTAAATTATTATGATTCGGGGAATTCTGTGTACCTTGAATCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-400(265.9),IGHV4-5500(265.9) IGHD3-1600(50),IGHD3-1000(49) IGHJ4*00(316.3) IGHG100(86.2),IGHG200(86.2),IGHG4*00(86.2) 442|450|473|0|8||80.0;442|450|473|0|8||80.0 38|48|111|15|25||50.0;33|54|93|13|34|SC37TSG42ASA46GSG51A|49.0 22|37|68|39|54|ST25CSC30ASA32C|63.0 ;; TGTGCGAGGGTAAATTATTATGATTCGGGGAATTCTGTGTACCTTGAATCCTGG 45 CARVNYYDSGNSVYLESW :::::::::0:-3:8:15πŸ‘Ž-26:25:39:-2:54:::
3742 174 0.000105097 16 9.50153e-05 TGTGCGAAAGGGATCAGTAACTTCTACGGTTTGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(544.1) IGHD4-1100(25),IGHD4-400(25),IGHD7-27*00(25) IGHJ6*00(425.9) IGHM*00(146) 442|452|473|0|10||100.0 22|27|48|14|19||25.0;22|27|48|14|19||25.0;19|24|33|10|15||25.0 29|52|83|19|42|SA32TSA40T|172.0 nan TGTGCGAAAGGGATCAGTAACTTCTACGGTTTGGACGTCTGG 45 CAKGISNFYGLDVW :::::::::0:-1:10:14:-6:-5:19:19:-9:42:::
3743 174 0.000105097 20 0.000118769 TGTGCAAGAGTCGGCAAGACGGCTTACGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV6-1*00(522.6) IGHD5-2400(26),IGHD2-200(25),IGHD6-25*00(25) IGHJ6*00(486.6) IGHM*00(154.8) 454|464|485|0|10||100.0 24|32|60|16|24|ST27C|26.0;61|66|93|11|16||25.0;29|34|54|19|24||25.0 34|52|83|24|42||180.0 nan TGTGCAAGAGTCGGCAAGACGGCTTACGGTATGGACGTCTGG 45 CARVGKTAYGMDVW :::::::::0:-1:10:16:-4:-8:24:24:-14:42:::
3744 174 0.000105097 17 0.000100954 TGTACAAGGGACCCGAGAGGATATAGCGGTTATGATCACTACGACAGGGAATACACCTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-24*00(223.1) IGHD5-1200(49),IGHD3-2200(44) IGHJ5*00(431.3) nan 442|449|473|0|7|SG445A|41.0 25|46|69|18|39|ST33CSC36TSC39TST43C|49.0;41|56|93|19|33|DG45ST49C|44.0 19|40|71|51|72|SA23C|181.0 nan TGTACAAGGGACCCGAGAGGATATAGCGGTTATGATCACTACGACAGGGAATACACCTGGTTCGACCCCTGG 45 CTRDPRGYSGYDHYDREYTWFDPW :::::::::0:-4:7:18:-2:0:39:51:1:72:::
3771 173 0.000104493 13 7.71999e-05 TGTGCGCGAGGGGGGCCCAGGCCGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-8*00(678.4) IGHD7-27*00(25) IGHJ5*00(307.7) nan 442|453|473|0|11|SA448C|81.0 2|7|33|15|20||25.0 27|40|71|23|36||130.0 nan TGTGCGCGAGGGGGGCCCAGGCCGTTCGACCCCTGG 45 CARGGPRPFDPW :::::::::0:0:11:15:9:-15:20:23:-7:36:::
3772 173 0.000104493 16 9.50153e-05 TGTGCGAGAGGGTTCAGTTATTACAACGGTTTGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-35*00(246.7) IGHD3-10*00(35) IGHJ6*00(371.4) IGHM*00(147.8) 442|451|473|0|9|ST446C|61.0 41|48|93|10|17||35.0 28|52|83|18|42|SC30TST34ASA40T|153.0 nan TGTGCGAGAGGGTTCAGTTATTACAACGGTTTGGACGTCTGG 45 CARGFSYYNGLDVW :::::::::0:-2:9:10:-10:-14:17:18:-8:42:::
3773 173 0.000104493 18 0.000106892 TGTGCGAGAGATAACTTTCTCGGTGGCTGGTATTCTTTTGACCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-5900(379.1),IGHV4-6100(379.1) IGHD6-19*00(45) IGHJ3*00(304.7) IGHA100(118.7),IGHA200(118.7) 439|451|470|0|12||120.0;445|457|476|0|12||120.0 31|40|63|22|31||45.0 22|39|70|31|48|SG24TST32CSA33C|83.0 ; TGTGCGAGAGATAACTTTCTCGGTGGCTGGTATTCTTTTGACCTCTGG 45 CARDNFLGGWYSFDLW :::::::::0:1:12:22:-10:-2:31:31:-2:48:::
3774 173 0.000104493 16 9.50153e-05 TGTGCGAAACGGGGGAGTGGCGCCGCGTGCTTCTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(935.5) IGHD3-1600(40),IGHD3-300(35) IGHJ4*00(211.3) nan 442|451|473|0|9||90.0 54|62|111|10|18||40.0;45|52|93|13|20||35.0 18|37|68|26|45|SA20GSA23T|132.0 nan TGTGCGAAACGGGGGAGTGGCGCCGCGTGCTTCTTTGACTACTGG 45 CAKRGSGAACFFDYW :::::::::0:-2:9:10:-17:-12:18:26:2:45:::
3776 173 0.000104493 19 0.000112831 TGTATCACAGATCCCTTTTCCTATGATATTAGTGGAGGGGACTGCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-15*00(362.9) IGHD3-22*00(62) IGHJ4*00(322.9) IGHA100(116.9),IGHA200(116.9) 448|461|479|0|13|SC452T|101.0 34|52|93|17|35|SA36CSG45T|62.0 28|37|68|39|48|SA32G|61.0 ; TGTATCACAGATCCCTTTTCCTATGATATTAGTGGAGGGGACTGCTGG 45 CITDPFSYDISGGDCW :::::::::0:2:13:17:-3:-10:35:39:-8:48:::
3799 172 0.000103889 17 0.000100954 TGTGCGAAACCTGGTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(516.2) nan IGHJ4*00(406.3) IGHM*00(233.3) 442|451|473|0|9||90.0 nan 27|37|68|14|24||100.0 nan TGTGCGAAACCTGGTGACTACTGG 45 CAKPGDYW :::::::::0:-2:9:::::14:-7:24:::
3800 172 0.000103889 17 0.000100954 TGTGCGAAAGCAGTGGGGTTCGTCGACCAGAGCACGACTCAGGAGGCTTTTGATGTGTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-30*00(349) IGHD1-2600(30),IGHD6-1900(30),IGHD2-15*00(28) IGHJ3*00(324.4) IGHA100(59.4),IGHA200(59.4) 442|452|473|0|10||100.0 25|31|60|11|17||30.0;29|35|63|10|16||30.0;41|50|93|11|19|DT46|28.0 17|39|70|38|60|ST20GST23GSA33GSC35G|104.0 ; TGTGCGAAAGCAGTGGGGTTCGTCGACCAGAGCACGACTCAGGAGGCTTTTGATGTGTGG 45 CAKAVGFVDQSTTQEAFDVW :::::::::0:-1:10:11:-5:-9:17:38:3:60:::
3801 172 0.000103889 18 0.000106892 TGTGCGAAAGGTGGTTACTGTGGTTCGGGGAGTTCTTATAGTGAACGCCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(510.3) IGHD3-10*00(88) IGHJ400(328.2),IGHJ500(319.4) IGHM*00(88) 442|452|473|0|10||100.0 34|60|93|14|40|SA39GSA46GSA54C|88.0 32|37|68|49|54||50.0;33|40|71|47|54|SC35A|41.0 nan TGTGCGAAAGGTGGTTACTGTGGTTCGGGGAGTTCTTATAGTGAACGCCACTGG 45 CAKGGYCGSGSSYSERHW :::::::::0:-1:10:14:-3:-2:40:49:-12:54:::
3818 171 0.000103285 16 9.50153e-05 TGTGCCAGAGATCGACTGTGGTACGGACACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-30-200(387.2),IGHV4-5900(385.4),IGHV4-61*00(385.4) IGHD6-1300(36),IGHD6-1900(36),IGHD4-23*00(31) IGHJ4*00(388.3) IGHA100(153.3),IGHA200(153.3) 445|458|476|0|13||130.0;439|452|470|0|13|SG444C|101.0;445|458|476|0|13|SG450C|101.0 36|46|63|18|28|ST43G|36.0;36|46|63|18|28|ST43G|36.0;24|33|57|14|23|SG26T|31.0 23|37|68|28|42||140.0 ; TGTGCCAGAGATCGACTGTGGTACGGACACTTTGACTACTGG 45 CARDRLWYGHFDYW :::::::::0:2:13:18:-15:4:28:28:-3:42:::
3819 171 0.000103285 13 7.71999e-05 TGTGCGAGAGATTACTATGATAGTCGTGGTTATCTAAGCTTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-4*00(318.7) IGHD3-22*00(91) IGHJ4*00(391.8) IGHM*00(94.4) 442|454|473|0|12||120.0 35|56|93|12|33|SA47C|91.0 24|37|68|38|51|SA32C|101.0 nan TGTGCGAGAGATTACTATGATAGTCGTGGTTATCTAAGCTTTGACTCCTGG 45 CARDYYDSRGYLSFDSW :::::::::0:1:12:12:-4:-6:33:38:-4:51:::
3820 171 0.000103285 18 0.000106892 TGTGCGAGAGAACTGGCCCGAACCTATTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-46*00(763.5) IGHD3-1000(28),IGHD1-1400(26) IGHJ4*00(273.5) nan 442|456|473|0|14|ST453A|111.0 12|21|93|16|24|DT15|28.0;24|32|51|16|24|SG26C|26.0 19|37|68|24|42|SC21T|151.0 nan TGTGCGAGAGAACTGGCCCGAACCTATTACTTTGACTACTGG 45 CARELARTYYFDYW :::::::::0:3:14:16:19:-41:24:24:1:42:::
3821 171 0.000103285 15 8.90768e-05 TGTGCGAGAGAAGCGGTGGTAGGTGCTGAGGCCGAATACTTCCAGCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-2*00(867) IGHD2-15*00(52) IGHJ1*00(307.1) nan 442|453|473|0|11||110.0 41|57|93|11|27|ST43CSC52G|52.0 20|41|72|30|51|ST22C|181.0 nan TGTGCGAGAGAAGCGGTGGTAGGTGCTGAGGCCGAATACTTCCAGCACTGG 45 CAREAVVGAEAEYFQHW :::::::::0:0:11:11:-10:-5:27:30:0:51:::
3824 171 0.000103285 13 7.71999e-05 TGTACCACAGGCGGAACGGTACAGCTATGGTTAGCGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-15*00(914) IGHD5-5*00(70) IGHJ4*00(206.5) nan 448|458|479|0|10||100.0 25|39|60|19|33||70.0 28|37|68|36|45||90.0 nan TGTACCACAGGCGGAACGGTACAGCTATGGTTAGCGGACTACTGG 45 CTTGGTVQLWLADYW :::::::::0:-1:10:19:-5:-1:33:36:-8:45:::
3841 170 0.000102681 23 0.000136584 TGTGTAAGAGGGAACGATGGCTACGGCGTTTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(839.8) IGHD5-2400(45),IGHD5-1200(40),IGHD5-18*00(40) IGHJ4*00(167.7) nan 442|452|473|0|10|SC446T|71.0 25|34|60|15|24||45.0;33|41|69|17|25||40.0;33|41|69|17|25||40.0 25|37|68|30|42||120.0 nan TGTGTAAGAGGGAACGATGGCTACGGCGTTTTTGACTACTGG 45 CVRGNDGYGVFDYW :::::::::0:-1:10:15:-5:-6:24:30:-5:42:::
3846 170 0.000102681 20 0.000118769 TGTGCGCGAGTCCGGCATCCGAGTGACTTCGACTACTATGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-34*00(665.1) IGHD4-17*00(31) IGHJ4*00(168.9) nan 439|452|470|0|13|SA445CSG449T|72.0 24|33|48|22|31|SA30T|31.0 20|37|68|31|48|ST26ASA32C|112.0 nan TGTGCGCGAGTCCGGCATCCGAGTGACTTCGACTACTATGACTCCTGG 45 CARVRHPSDFDYYDSW :::::::::0:2:13:22:-8:1:31:31:0:48:::
3847 170 0.000102681 19 0.000112831 TGTGCGGGAGGCGGCGGCTGGACGTCTGAATTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(858.4),IGHV3-700(858.4) IGHD6-1900(38),IGHD6-1300(35) IGHJ400(168.2),IGHJ500(166.2) nan 442|452|473|0|10|SA448G|71.0;442|452|473|0|10|SA448G|71.0 33|44|63|15|25|DT39|38.0;28|44|63|10|25|SA30GSA33GDT39|35.0 27|37|68|26|36|SC30ASA32T|42.0;36|40|71|32|36||40.0 nan TGTGCGGGAGGCGGCGGCTGGACGTCTGAATTCTGG 45 CAGGGGWTSEFW :::::::::0:-1:10:15:-12:2:25:26:-7:36:::
3848 170 0.000102681 16 9.50153e-05 TGTGCGAGACAGGGATTTACTATGATAGTAGGTAGTCTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(879.4),IGHV3-700(879.4) IGHD3-22*00(75) IGHJ4*00(179.9) nan 442|451|473|0|9||90.0;442|451|473|0|9||90.0 34|49|93|16|31||75.0 26|37|68|37|48||110.0 nan TGTGCGAGACAGGGATTTACTATGATAGTAGGTAGTCTTGACTACTGG 45 CARQGFTMIVGSLDYW :::::::::0:-2:9:16:-3:-13:31:37:-6:48:::
3849 170 0.000102681 17 0.000100954 TGTGCGAAAGGGATCAGTTACTATAACGCTGTGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(909.9) IGHD7-27*00(25) IGHJ6*00(239.2) nan 442|452|473|0|10||100.0 19|24|33|10|15||25.0 28|52|83|18|42|SC33TST34ASG38CSA40G|124.0 nan TGTGCGAAAGGGATCAGTTACTATAACGCTGTGGACGTCTGG 45 CAKGISYYNAVDVW :::::::::0:-1:10:10:-8:2:15:18:-8:42:::
3879 169 0.000102077 17 0.000100954 TGTGCGAGAGAGGTGGGGCCAACGGAGACAGCCCGTTGGCTGTTTCCTTTGGGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(334.3) IGHD5-500(31),IGHD6-1900(30) IGHJ400(267.6),IGHJ500(267.6) IGHG100(88.6),IGHG200(88.6),IGHG400(88.6),IGHGP00(88.6) 442|453|473|0|11||110.0 9|18|60|38|47|SA14T|31.0;32|38|63|36|42||30.0 35|37|68|52|54||20.0;38|40|71|52|54||20.0 ;;; TGTGCGAGAGAGGTGGGGCCAACGGAGACAGCCCGTTGGCTGTTTCCTTTGGGG 45 CAREVGPTETARWLFPLG :::::::::0:0:11:38:11:-22:47:52:-15:54:::
3880 169 0.000102077 16 9.50153e-05 TGTGCACGGACGAGATATAGCACTGGCTTGTACTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-70*00(881.6) IGHD6-19*00(51) IGHJ4*00(258.1) nan 445|455|478|0|10||100.0 24|37|63|15|28|SG31C|51.0 18|37|68|29|48||190.0 nan TGTGCACGGACGAGATATAGCACTGGCTTGTACTACTTTGACTACTGG 45 CARTRYSTGLYYFDYW :::::::::0:-3:10:15:-3:-5:28:29:2:48:::
3881 169 0.000102077 16 9.50153e-05 TGTGCACACAGGGGGGGAGATGGCTACAATTTGGGGTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-5*00(940.1) IGHD5-24*00(75) IGHJ4*00(189.1) nan 445|456|478|0|11||110.0 23|38|60|16|31||75.0 25|37|68|36|48||120.0 nan TGTGCACACAGGGGGGGAGATGGCTACAATTTGGGGTTTGACTACTGG 45 CAHRGGDGYNLGFDYW :::::::::0:-2:11:16:-3:-2:31:36:-5:48:::
3883 169 0.000102077 20 0.000118769 TGTGCAGGAGACTTTCCCTTCGATTCGGGGAGTTATGCTTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(871.2) IGHD3-1000(51),IGHD3-1600(51) IGHJ4*00(162.7) nan 442|453|473|0|11|SA448G|81.0 43|56|93|23|36|SA46G|51.0;52|65|111|23|36|SG54C|51.0 25|37|68|39|51||120.0 nan TGTGCAGGAGACTTTCCCTTCGATTCGGGGAGTTATGCTTTTGACTACTGG 45 CAGDFPFDSGSYAFDYW :::::::::0:0:11:23:-12:-6:36:39:-5:51:::
3911 168 0.000101473 16 9.50153e-05 TGTGCGAGGTCGGGGTATAGCGCCTCGTCCATGTTTGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(862.3) IGHD6-600(52),IGHD6-1300(45),IGHD6-25*00(45) IGHJ4*00(204.4) nan 445|453|476|0|8||80.0 20|36|54|14|30|SA27GSG28C|52.0;21|30|63|12|21||45.0;18|27|54|12|21||45.0 25|37|68|33|45|ST31C|91.0 nan TGTGCGAGGTCGGGGTATAGCGCCTCGTCCATGTTTGACCACTGG 45 CARSGYSASSMFDHW :::::::::0:-3:8:14:-2:0:30:33:-5:45:::
3912 168 0.000101473 19 0.000112831 TGTGCGAGAGATGTTATCGACCGTGGAGATGGCTACAATTGGGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-2*00(830.6) IGHD5-24*00(81) IGHJ1*00(189.3) nan 442|454|473|0|12||120.0 19|38|60|21|40|SA22G|81.0 35|41|72|45|51||60.0 nan TGTGCGAGAGATGTTATCGACCGTGGAGATGGCTACAATTGGGACCACTGG 45 CARDVIDRGDGYNWDHW :::::::::0:1:12:21:1:-2:40:45:-15:51:::
3913 168 0.000101473 14 8.31384e-05 TGTGCGAGAGAGGGAAGCGCAGCCATGGCGATAATCGGTGATGCTCTTGATTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-2100(542.7),IGHV3-3300(542.7) IGHD5-500(31),IGHD5-1200(30),IGHD5-24*00(30) IGHJ3*00(439.6) IGHA100(74.5),IGHA200(74.5) 442|453|473|0|11||110.0;442|453|473|0|11||110.0 27|36|60|19|28|ST31C|31.0;1|7|69|31|37||30.0;8|14|60|20|26||30.0 20|39|70|38|57|ST27CSA33T|132.0 ; TGTGCGAGAGAGGGAAGCGCAGCCATGGCGATAATCGGTGATGCTCTTGATTTCTGG 45 CAREGSAAMAIIGDALDFW :::::::::0:0:11:19:-7:-4:28:38:0:57:::
3914 168 0.000101473 20 0.000118769 TGTGCGAAAGATGGCCGGTTACGTTTGGGGGAGCCCCATGAATACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(536.4) IGHD3-16*00(61) IGHJ4*00(454.5) IGHM*00(74.2) 442|454|473|0|12||120.0 46|61|111|18|33|SA50G|61.0 22|37|68|42|57||150.0 nan TGTGCGAAAGATGGCCGGTTACGTTTGGGGGAGCCCCATGAATACTTTGACTACTGG 45 CAKDGRLRLGEPHEYFDYW :::::::::0:1:12:18:-9:-13:33:42:-2:57:::
3915 168 0.000101473 18 0.000106892 TGTGCGAAAGACCGATGGGGAACAACCATAAAATACCTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-30*00(799.8) IGHD3-1000(35),IGHD5-500(35),IGHD7-27*00(30) IGHJ4*00(162) nan 442|453|473|0|11||110.0 17|24|93|23|30||35.0;2|9|60|23|30||35.0;16|22|33|15|21||30.0 22|37|68|33|48|ST25CSA32C|92.0 nan TGTGCGAAAGACCGATGGGGAACAACCATAAAATACCTTGACTCCTGG 45 CAKDRWGTTIKYLDSW :::::::::0:0:11:23:14:-38:30:33:-2:48:::
3917 168 0.000101473 16 9.50153e-05 TGTGCAAGAGATTCCGGCCGGGGCAGCTGGGTGGACTTTGACTGCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-13*00(881.4) IGHD2-200(40),IGHD6-1300(40) IGHJ4*00(165) nan 439|451|470|0|12||120.0 6|14|93|22|30||40.0;31|39|63|22|30||40.0 23|37|68|34|48|SA32G|111.0 nan TGTGCAAGAGATTCCGGCCGGGGCAGCTGGGTGGACTTTGACTGCTGG 45 CARDSGRGSWVDFDCW :::::::::0:1:12:22:25:-48:30:34:-3:48:::
3918 168 0.000101473 16 9.50153e-05 TGTACGACCCGAAGCCCCAGGGGTGACTACGGAAGGTACTACTACGGTATGGACATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(391.6) IGHD4-1700(50),IGHD4-2300(45) IGHJ6*00(460.4) IGHG100(65.4),IGHG200(65.4),IGHG400(65.4),IGHGP00(65.4) 442|449|473|0|7|SG445A|41.0 23|33|48|21|31||50.0;19|28|57|23|32||45.0 28|52|83|36|60|SG46A|211.0 ;;; TGTACGACCCGAAGCCCCAGGGGTGACTACGGAAGGTACTACTACGGTATGGACATCTGG 45 CTTRSPRGDYGRYYYGMDIW :::::::::0:-4:7:21:-7:1:31:36:-8:60:::
3922 168 0.000101473 18 0.000106892 TGCGCGAGAAGATCGTGGGCACAGACTTGGTCCGAATACTATTTTGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-5900(398.9),IGHV4-6100(398.9) IGHD5-5*00(33) IGHJ4*00(397.9) IGHG100(97.7),IGHG200(97.7),IGHG400(97.7),IGHGP00(97.7) 439|448|470|0|9|ST441C|61.0;445|454|476|0|9|ST447C|61.0 19|37|60|13|31|SA24GST25CI30ADA32|33.0 19|37|68|36|54|SC24TSA32T|122.0 ;;; TGCGCGAGAAGATCGTGGGCACAGACTTGGTCCGAATACTATTTTGACTTCTGG 45 CARRSWAQTWSEYYFDFW :::::::::0:-2:9:13:1:-3:31:36:1:54:::
3938 167 0.000100869 15 8.90768e-05 TGTGCGAGCGAGGGTGGCTATTGG NNNNNNNNNNNNNNNNNNNNNNNN IGHV1-69D*00(545.6) nan IGHJ4*00(318.4) IGHA100(54.2),IGHA200(54.2) 442|453|473|0|11|SA450C|81.0 nan 27|37|68|14|24|SA29GSC33T|42.0 ; TGTGCGAGCGAGGGTGGCTATTGG 45 CASEGGYW :::::::::0:0:11:::::14:-7:24:::
3939 167 0.000100869 17 0.000100954 TGTGCGAGAACTTCCGACTACAATCACTATTCCCCTGTCGACTTTTACTTCGATGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-400(337.6),IGHV4-5500(337.6) IGHD2-2100(42),IGHD4-1100(42),IGHD4-4*00(42) IGHJ2*00(310) IGHA100(65.4),IGHA200(65.4) 442|451|473|0|9||90.0;442|451|473|0|9||90.0 52|70|84|11|27|DG56SA59CDG62|42.0;17|31|48|15|29|SG24ASA26C|42.0;17|31|48|15|29|SG24ASA26C|42.0 27|42|73|45|60|SC36G|121.0 ; TGTGCGAGAACTTCCGACTACAATCACTATTCCCCTGTCGACTTTTACTTCGATGTCTGG 45 CARTSDYNHYSPVDFYFDVW :::::::::0:-2:9:11:-24:14:27:45:-7:60:::
3940 167 0.000100869 18 0.000106892 TGTGCGAAGGATCATTGCCGGGGTCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(954.3) IGHD2-200(25),IGHD6-1300(25),IGHD6-25*00(25) IGHJ5*00(291.9) nan 442|458|473|0|16|SA450GST455A|102.0 59|64|93|16|21||25.0;19|24|63|17|22||25.0;16|21|54|17|22||25.0 34|40|71|24|30||60.0 nan TGTGCGAAGGATCATTGCCGGGGTCCCTGG 45 CAKDHCRGPW :::::::::0:5:16:16:-28:2:21:24:-14:30:::
3941 167 0.000100869 13 7.71999e-05 TGTGCGAAAGAATTCATAGTGGCTATTGAGTTCGGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(823.9) IGHD5-1200(50),IGHD5-1800(50) IGHJ4*00(194) nan 442|453|473|0|11||110.0 29|39|69|15|25||50.0;29|39|69|15|25||50.0 26|37|68|25|36|SC30GSA32TST34G|23.0 nan TGTGCGAAAGAATTCATAGTGGCTATTGAGTTCGGG 45 CAKEFIVAIEFG :::::::::0:0:11:15:-6:-7:25:25:-6:36:::
3943 167 0.000100869 17 0.000100954 TGTGCAACCCGGGGGTGGATACAGCTATGGTTACCTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(980.1) IGHD5-5*00(100) IGHJ4*00(188.3) nan 442|447|473|0|5||50.0 20|40|60|14|34||100.0 27|37|68|35|45||100.0 nan TGTGCAACCCGGGGGTGGATACAGCTATGGTTACCTGACTACTGG 45 CATRGWIQLWLPDYW :::::::::0:-6:5:14:0:0:34:35:-7:45:::
3959 166 0.000100265 15 8.90768e-05 TGTGTTGCGGGGGGCGGAGGGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-18*00(618.6) IGHD2-1500(25),IGHD3-1600(25),IGHD4-23*00(25) IGHJ4*00(394.3) IGHM*00(82.6) 442|446|473|0|4||40.0 61|66|93|14|19||25.0;54|59|111|8|13||25.0;37|42|57|14|19||25.0 28|37|68|21|30||90.0 nan TGTGTTGCGGGGGGCGGAGGGGACTACTGG 45 CVAGGGGDYW :::::::::0:-7:4:14:-30:4:19:21:-8:30:::
3966 166 0.000100265 17 0.000100954 TGTGGAAGAGATACGGGCGGTTCGGCGAGCCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(399.1) IGHD3-1000(27),IGHD1-1400(25) IGHJ500(329),IGHJ400(328) IGHG1*00(177.1) 442|454|473|0|12|SC446G|91.0 41|52|93|18|29|SA46GSG48C|27.0;2|7|51|18|23||25.0 33|40|71|29|36|SC35T|41.0;33|37|68|32|36||40.0 nan TGTGGAAGAGATACGGGCGGTTCGGCGAGCCTCTGG 45 CGRDTGGSASLW :::::::::0:1:12:18:-10:-10:29:29:-13:36:::
3983 165 9.96612e-05 16 9.50153e-05 TGTGTGAGACATACCCGGATACCCTTTGATCGATGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(937) IGHD6-1300(31),IGHD6-1900(31),IGHD6-25*00(31) IGHJ400(214.1),IGHJ500(214.1) nan 442|454|473|0|12|SC446T|91.0 17|26|63|12|21|SG23A|31.0;17|26|63|12|21|SG23A|31.0;14|23|54|12|21|SG20A|31.0 34|37|68|33|36||30.0;37|40|71|33|36||30.0 nan TGTGTGAGACATACCCGGATACCCTTTGATCGATGG 45 CVRHTRIPFDRW :::::::::0:1:12:12:4:-16:21:33:-14:36:::
3994 165 9.96612e-05 15 8.90768e-05 TGTGCGAAAGCGACTATAGCAGCTCGACTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(451) IGHD6-6*00(66) IGHJ4*00(348.3) IGHA100(162.3),IGHA200(162.3) 442|452|473|0|10||100.0 17|33|54|10|26|SG20C|66.0 26|37|68|28|39|SA32C|81.0 ; TGTGCGAAAGCGACTATAGCAGCTCGACTTGACTCCTGG 45 CAKATIAARLDSW :::::::::0:-1:10:10:1:-3:26:28:-6:39:::
4000 165 9.96612e-05 14 8.31384e-05 TGCGCGAGAGGACATGCGGAACTGGGCTATTTCTACTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-8*00(256.6) IGHD1-2600(35),IGHD2-200(35),IGHD7-27*00(35) IGHJ6*00(354.4) IGHA100(59),IGHA200(59) 442|453|473|0|11|ST444C|81.0 33|40|60|32|39||35.0;16|23|93|32|39||35.0;13|20|33|19|26||35.0 40|52|83|39|51||120.0 ; TGCGCGAGAGGACATGCGGAACTGGGCTATTTCTACTACATGGACGTCTGG 45 CARGHAELGYFYYMDVW :::::::::0:0:11:32:-13:0:39:39:-20:51:::
4014 164 9.90572e-05 17 0.000100954 TGTGTGAGCGAGGGTGGTTATTGG NNNNNNNNNNNNNNNNNNNNNNNN IGHV1-46*00(323.2) IGHD2-1500(30),IGHD2-2100(30),IGHD4-23*00(30) IGHJ4*00(271.2) IGHA1*00(141.9) 442|453|473|0|11|SC446TSA450C|52.0 44|50|93|12|18||30.0;38|44|84|12|18||30.0;26|32|57|12|18||30.0 31|37|68|18|24|SC33T|31.0 nan TGTGTGAGCGAGGGTGGTTATTGG 45 CVSEGGYW :::::::::0:0:11:12:-13:-12:18:18:-11:24:::
4022 164 9.90572e-05 18 0.000106892 TGTGCGAGAGGGTTGTTTGGTTCCAGCCACGAAAGGGAGCGATACAATTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-400(277.7),IGHV4-5500(272.2) IGHD6-1900(41),IGHD1-1400(35),IGHD1-7*00(35) IGHJ5*00(476.1) IGHM*00(52.2) 442|452|473|0|10||100.0;442|451|473|0|9||90.0 0|11|63|19|30|SA2T|41.0;1|8|51|17|24||35.0;3|10|51|19|26||35.0 19|40|71|42|63|SC24T|181.0 nan TGTGCGAGAGGGTTGTTTGGTTCCAGCCACGAAAGGGAGCGATACAATTGGTTCGACCCCTGG 45 CARGLFGSSHERERYNWFDPW :::::::::0:-1:10:19:21:-31:30:42:1:63:::
4023 164 9.90572e-05 17 0.000100954 TGTGCGAATGGCGGTGGGACCTACCCCGACTGGCACTTCGATCTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(362.8) IGHD1-26*00(41) IGHJ2*00(463.2) IGHM*00(116.1) 442|450|473|0|8||80.0 26|37|60|13|24|SG32C|41.0 22|42|73|28|48|ST27C|171.0 nan TGTGCGAATGGCGGTGGGACCTACCCCGACTGGCACTTCGATCTCTGG 45 CANGGGTYPDWHFDLW :::::::::0:-3:8:13:-6:-3:24:28:-2:48:::
4024 164 9.90572e-05 16 9.50153e-05 TGTGCGAAGACGTTTTACGATCTTTTCACTTACCAGAACTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-31*00(361.9) IGHD3-900(63),IGHD3-300(54) IGHJ5*00(450.6) IGHA100(89.6),IGHA200(89.6) 445|452|476|0|7||70.0 29|50|93|9|30|SA33TSA41CSG46C|63.0;29|45|93|9|26|SA33TI41C|54.0 22|40|71|36|54||180.0 ; TGTGCGAAGACGTTTTACGATCTTTTCACTTACCAGAACTGGTTCGACCCCTGG 45 CAKTFYDLFTYQNWFDPW :::::::::0:-4:7:9:2:-12:30:36:-2:54:::
4025 164 9.90572e-05 17 0.000100954 TGTGCAAGGGCAAGAGATGGCCTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-13*00(803.5) IGHD5-24*00(45) IGHJ4*00(275.5) nan 439|447|470|0|8||80.0 22|31|60|12|21||45.0 26|37|68|22|33||110.0 nan TGTGCAAGGGCAAGAGATGGCCTTGACTACTGG 45 CARARDGLDYW :::::::::0:-3:8:12:-2:-9:21:22:-6:33:::
4026 164 9.90572e-05 20 0.000118769 TGTGGTAGACTGCAGTGGTACGCTTTTGATATGTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-21*00(674.6) IGHD2-200(38),IGHD6-1300(38),IGHD4-23*00(37) IGHJ3*00(273.4) nan 442|446|473|0|4||40.0 6|17|93|11|21|DC10|38.0;31|42|63|11|21|DC35|38.0;20|33|57|7|20|SA24GSG26A|37.0 24|39|70|21|36|SC35G|121.0 nan TGTGGTAGACTGCAGTGGTACGCTTTTGATATGTGG 45 CGRLQWYAFDMW :::::::::0:-7:4:11:25:-45:21:21:-4:36:::
4028 164 9.90572e-05 13 7.71999e-05 TGTACCAGAGAAGCTACGTTGACTACATGGAGGAACTTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-2*00(741.8) IGHD4-17*00(51) IGHJ4*00(212.8) nan 442|453|473|0|11|SG445ASG447C|52.0 19|32|48|13|26|SG24T|51.0 23|37|68|34|48|SA32C|111.0 nan TGTACCAGAGAAGCTACGTTGACTACATGGAGGAACTTTGACTCCTGG 45 CTREATLTTWRNFDSW :::::::::0:0:11:13:-3:0:26:34:-3:48:::
4060 163 9.84532e-05 17 0.000100954 TGTGCGAAAGGGATCAGTTACTCCTACGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(850) IGHD7-27*00(25) IGHJ6*00(315.1) nan 442|452|473|0|10||100.0 19|24|33|10|15||25.0 28|52|83|18|42|SA32C|211.0 nan TGTGCGAAAGGGATCAGTTACTCCTACGGTATGGACGTCTGG 45 CAKGISYSYGMDVW :::::::::0:-1:10:10:-8:2:15:18:-8:42:::
4061 163 9.84532e-05 16 9.50153e-05 TGTGCGAAAGGGAGCAATTACTACCACGATATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(535) IGHD2-21*00(30) IGHJ6*00(465.9) IGHM*00(146.2) 442|452|473|0|10||100.0 5|11|84|12|18||30.0 28|52|83|18|42|ST34CSG38A|182.0 nan TGTGCGAAAGGGAGCAATTACTACCACGATATGGACGTCTGG 45 CAKGSNYYHDMDVW :::::::::0:-1:10:12:23:-45:18:18:-8:42:::
4074 162 9.78492e-05 15 8.90768e-05 TGTGTAAGAGGTAACTCTGGTTACGGGATCTTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(787.3) IGHD5-500(41),IGHD4-2300(36),IGHD3-9*00(35) IGHJ4*00(159.4) nan 442|452|473|0|10|SC446T|71.0 30|41|60|14|25|SA32C|41.0;30|40|57|10|20|SC37T|36.0;48|55|93|16|23||35.0 24|37|68|29|42|SA32C|101.0 nan TGTGTAAGAGGTAACTCTGGTTACGGGATCTTTGACTCCTGG 45 CVRGNSGYGIFDSW :::::::::0:-1:10:14:-10:1:25:29:-4:42:::
4080 162 9.78492e-05 17 0.000100954 TGTGCCCCCAGGACTTGGATACAACTATGGATGCCTGACTACTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(440.2) IGHD5-5*00(62) IGHJ6*00(397.1) IGHM*00(74.8) 442|447|473|0|5||50.0 18|36|60|12|30|SG20TSG29A|62.0 40|52|83|45|57||120.0 nan TGTGCCCCCAGGACTTGGATACAACTATGGATGCCTGACTACTACATGGACGTCTGG 45 CAPRTWIQLWMPDYYMDVW :::::::::0:-6:5:12:2:-4:30:45:-20:57:::
4087 162 9.78492e-05 17 0.000100954 TGTGCGACTACGACGGGGGGACTATACTACTTTACCCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV5-51*00(342.1) IGHD1-2600(35),IGHD2-200(35),IGHD6-6*00(35) IGHJ1*00(272.4) IGHA100(155.4),IGHA200(155.4) 442|449|473|0|7||70.0 12|19|60|20|27||35.0;14|21|93|24|31||35.0;10|17|54|21|28||35.0 35|41|72|36|42||60.0 ; TGTGCGACTACGACGGGGGGACTATACTACTTTACCCACTGG 45 CATTTGGLYYFTHW :::::::::0:-4:7:20:8:-21:27:36:-15:42:::
4088 162 9.78492e-05 15 8.90768e-05 TGTGCGACCCGAACGTGGATACAGCTATGGTTACCGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(490.9) IGHD5-5*00(110) IGHJ4*00(375.9) IGHM*00(132.3) 442|449|473|0|7||70.0 18|40|60|12|34||110.0 28|37|68|36|45||90.0 nan TGTGCGACCCGAACGTGGATACAGCTATGGTTACCGGACTACTGG 45 CATRTWIQLWLPDYW :::::::::0:-4:7:12:2:0:34:36:-8:45:::
4089 162 9.78492e-05 14 8.31384e-05 TGTGCACACACTCCCGCCATGGTCCGACCAACCTTTATATTTTATCAGTATTACATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-5*00(441.9) IGHD3-1000(35),IGHD3-2200(35),IGHD3-3*00(35) IGHJ6*00(369.1) IGHA100(40),IGHA200(40) 445|455|478|0|10||100.0 31|38|93|47|54||35.0;31|38|93|47|54||35.0;31|38|93|47|54||35.0 40|52|83|54|66||120.0 ; TGTGCACACACTCCCGCCATGGTCCGACCAACCTTTATATTTTATCAGTATTACATGGACGTCTGG 45 CAHTPAMVRPTFIFYQYYMDVW :::::::::0:-3:10:47:0:-24:54:54:-20:66:::
4107 161 9.72452e-05 18 0.000106892 TGTGTACACCTGACTACGGTGACTACCGCAGTCGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-66*00(872.5) IGHD4-17*00(84) IGHJ4*00(217.2) nan 439|443|470|0|4||40.0 16|38|48|10|33|I31CST33C|84.0 28|37|68|33|42||90.0 nan TGTGTACACCTGACTACGGTGACTACCGCAGTCGACTACTGG 45 CVHLTTVTTAVDYW :::::::::0:-7:4:10:0:6:33:33:-8:42:::
4117 161 9.72452e-05 21 0.000124708 TGTGCGAAAGATGGGGGTAGAGATGGCTACAATTGGCTCGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-9*00(463.5) IGHD5-24*00(55) IGHJ5*00(164) nan 442|454|475|0|12|SA447G|91.0 20|31|60|16|27||55.0 19|40|71|27|48|SC24TST28CSC34T|123.0 nan TGTGCGAAAGATGGGGGTAGAGATGGCTACAATTGGCTCGACTCCTGG 45 CAKDGGRDGYNWLDSW :::::::::0:-1:12:16:0:-9:27:27:1:48:::
4118 161 9.72452e-05 18 0.000106892 TGTGCGAAAAGGGGGACGGTGACTACGTATGTCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(534.6) IGHD4-17*00(70) IGHJ4*00(359.3) IGHM*00(159.7) 442|451|473|0|9||90.0 21|35|48|15|29||70.0 27|37|68|29|39|SA29T|71.0 nan TGTGCGAAAAGGGGGACGGTGACTACGTATGTCTACTGG 45 CAKRGTVTTYVYW :::::::::0:-2:9:15:-5:3:29:29:-7:39:::
4134 160 9.66412e-05 16 9.50153e-05 TGTGTGAGAGGGGTAAAGGAATTACTTTGGTTCGGGGACTACCAAGAGTACTTTGACTGCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-4*00(301.6) IGHD3-10*00(62) IGHJ4*00(381.5) IGHG3*00(49.3) 442|452|473|0|10|SC446T|71.0 33|51|93|20|38|SA39TSA46G|62.0 22|37|68|48|63|SA32G|121.0 nan TGTGTGAGAGGGGTAAAGGAATTACTTTGGTTCGGGGACTACCAAGAGTACTTTGACTGCTGG 45 CVRGVKELLWFGDYQEYFDCW :::::::::0:-1:10:20:-2:-11:38:48:-2:63:::
4140 160 9.66412e-05 15 8.90768e-05 TGTGCGAGAGGTCTTAGTCCTGGAGCTTCTGATATGTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-48*00(189.1) IGHD4-1100(26),IGHD4-2300(26),IGHD4-4*00(26) IGHJ3*00(381.5) IGHA100(161.9),IGHA200(161.9) 442|456|473|0|14|SA452G|111.0 10|18|48|14|22|SA15C|26.0;13|21|57|14|22|SA18C|26.0;10|18|48|14|22|SA15C|26.0 24|39|70|24|39|ST28CSC35G|92.0 ; TGTGCGAGAGGTCTTAGTCCTGGAGCTTCTGATATGTGG 45 CARGLSPGASDMW :::::::::0:3:14:14:6:-14:22:24:-4:39:::
4141 160 9.66412e-05 16 9.50153e-05 TGTGCGAAAGATTGGAGACTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(544.7) IGHD3-3*00(25) IGHJ4*00(370.4) IGHA2*00(207.4) 442|454|473|0|12||120.0 44|49|93|12|17||25.0 26|37|68|19|30||110.0 nan TGTGCGAAAGATTGGAGACTTGACTACTGG 45 CAKDWRLDYW :::::::::0:1:12:12:-13:-13:17:19:-6:30:::
4177 159 9.60372e-05 14 8.31384e-05 TGTGCGAGAGTCAGGGTAACCAGCAGCAGCGACTACTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-66*00(962.6) IGHD6-13*00(45) IGHJ4*00(235.7) nan 439|449|470|0|10||100.0 27|36|63|21|30||45.0 20|37|68|31|48||170.0 nan TGTGCGAGAGTCAGGGTAACCAGCAGCAGCGACTACTTTGACTACTGG 45 CARVRVTSSSDYFDYW :::::::::0:-1:10:21:-6:-6:30:31:0:48:::
4178 159 9.60372e-05 17 0.000100954 TGTGCGAGAGGTCTTAGTCCTGGAGCTTCTGATATGTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(860.7) IGHD1-100(25),IGHD1-2000(25),IGHD1-7*00(25) IGHJ3*00(230.1) nan 442|457|473|0|15|SA449GSA452G|92.0 24|29|51|19|24||25.0;24|29|51|19|24||25.0;24|29|51|19|24||25.0 24|39|70|24|39|ST28CSC35G|92.0 nan TGTGCGAGAGGTCTTAGTCCTGGAGCTTCTGATATGTGG 45 CARGLSPGASDMW :::::::::0:4:15:19:-7:-5:24:24:-4:39:::

In order to run the analysis for all samples in the project on Linux we can use GNU Parallel in the following way:

#!/usr/bin/env bash

mkdir -p results

ls raw/*R1* |
    parallel -j 2 --line-buffer \
    "mixcr analyze cellecta-human-rna-xcr-umi-drivermap-air \
    {} \
    {=s:R1:R2:=} \
    {=s:.*/:results/:;s:_R.*::=}"

Under the hood pipeline

Under the hood cellecta-air-human preset actually executes the following pipeline:

align

Alignment of raw sequencing reads against reference database of V-, D-, J- and C- gene segments.

mixcr align \
    --species hsa \
    -p generic-amplicon-with-umi \
    -tag-pattern '^(R1:*) \ ^(UMI:N{14})' \
    --rna
    -OvParameters.parameters.floatingLeftBound=true \
    -OjParameters.parameters.floatingRightBound=false \
    -OcParameters.parameters.floatingRightBound=true
    --report results/Sample1.align.report.txt \
    --json-report results/Sample1.align.report.json \
     raw/Sample1_R1.fastq.gz \
     raw/Sample1_R2.fastq.gz \
     results/Sample1.vdjca

Option --report and --json-report are specified here explicitly.

--species hsa
determines the organism species (hsa for Homo Sapiens).
-p generic-amplicon-with-umi
a preset of MiXCR parameters for amplicon data and defines required parameters for UMI correction.
-tag-pattern '^(R1:*) \ ^(UMI:N{14})'
this pattern marks the UMI region and ensures primer sequences trimming.
--rna
Sets a V gene feature to align to VTranscriptWithP. Check gene features for more info.
-OvParameters.parameters.floatingLeftBound=true
Results in a local alignment algorithm for V gene left bound due to the primer sequence presence.
-OjParameters.parameters.floatingRightBound=false
Results in a global alignment algorithm for J gene right bound.
-OcParameters.parameters.floatingRightBound=true
Results in a local alignment algorithm for C gene right bound due to the primer sequence presence.

refineTagsAndSort

Corrects sequencing and PCR errors inside barcode sequences. This step does extremely important job by correcting artificial diversity caused by errors in barcodes. In the considered example project it corrects only sequences of UMIs.

Note

The bundle-umi-kaligner2-v1-base preset specified at the mixcr align step will turn on the automatic filtering of reads during this step. The filtering is based on the Otsu's method and automatically sets the threshold for number of reads per UMI. Only those UMIs that pass the threshold will be used in further analysis.

mixcr refineTagsAndSort \
    --report results/Sample1.refine.report.txt \
    --json-report results/Sample1.refine.report.json \
    results/Sample1.vdjca \
    results/Sample1.refined.vdjca

assemble

Assembles clonotypes and applies several layers of errors correction:

  • quality-dependent correction for sequencing errors
  • PCR-error correction by clustering
  • UMI-based error correction

Check mixcr assemble for more information.

mixcr assemble \
    -OassemblingFeatures="CDR3"
    --report results/Sample1.report.txt \
    --json-report results/Sample1.report.json \
    results/Sample1.refined.vdjca \
    results/Sample1.clns

Options --report and --json-report are specified here explicitly so that the report files will be appended with assembly report.

-OassemblingFeatures=CDR3
This option is specified here explicitly as by default the clones are assembled by CDR3 sequence.

export

Exports clonotypes from .clns file into human-readable tables. The preset used at the alignment step also modifies this command to export UMIs counts and fraction for each clone.

mixcr exportClones \
    results/Sample1.clns \
    results/Sample1.tsv

Quality control

Now when we have all files processed lets perform Quality Control. That can be easily done using mixcr exportQc function.

First we will look at the alignment report:

mixcr exportQc align \
    results/*.clns \
    figs/alignQc.pdf

align QC

From this plot we can tell that all samples have high alignment rate and ΡŒΡ‰ΠΊΡƒ Π΅Ρ€ΡƒΡ„Ρ‚ 90% of all reads from each sample have been successfully aligned to the reference sequences and CDR3 has been established.

Now we can check chains distribution plot:

mixcr exportQc chainUsage \
    results/*.clns \
    figs/chainUsage.pdf

chain usage QC

We clearly see that for every sample 5 chains were obtained (TRA,TRB,IGH,UGK,IGL)

Reports

Finally, MiXCR provides a very convenient way to look at the reports generated at ech step. Every .vdjca, .clns and .clna file holds all the reports for every MiXCR function that has been applied to this sample. E.g. in our case .clns file contains reports for mixcr align and mixcr assemble. To output this report use mixcr exportReports as shown bellow. Note --json parameter will output a JSON-formatted report.

mixcr exportReports \
    results/Sample1.clns \
    results/Sample1.report.txt
mixcr exportReports \
    --json \
    results/Sample1.clns \
    results/Sample1.report.json
Show report file
============== Align Report ==============
============== Align Report ==============
Total sequencing reads: 9718563
Successfully aligned reads: 8996138 (92.57%)
Chimeras: 7 (0%)
Alignment failed, no hits (not TCR/IG?): 922 (0.01%)
Alignment failed because of absence of J hits: 721503 (7.42%)
Overlapped: 0 (0%)
Overlapped and aligned: 0 (0%)
Alignment-aided overlaps: 0 (NaN%)
Overlapped and not aligned: 0 (0%)
No CDR3 parts alignments, percent of successfully aligned: 486 (0.01%)
Partial aligned reads, percent of successfully aligned: 80481 (0.89%)
TRA chains: 1318953 (14.66%)
TRA non-functional: 136353 (10.34%)
TRB chains: 2112628 (23.48%)
TRB non-functional: 49478 (2.34%)
TRD chains: 44783 (0.5%)
TRD non-functional: 2117 (4.73%)
TRG chains: 151598 (1.69%)
TRG non-functional: 76265 (50.31%)
IGH chains: 1919314 (21.33%)
IGH non-functional: 45899 (2.39%)
IGK chains: 1801988 (20.03%)
IGK non-functional: 57301 (3.18%)
IGL chains: 1646867 (18.31%)
IGL non-functional: 62120 (3.77%)
Realigned with forced non-floating bound: 0 (0%)
Realigned with forced non-floating right bound in left read: 0 (0%)
Realigned with forced non-floating left bound in right read: 0 (0%)
Tag parsing report:
  Total reads: 9718563
  Matched reads: 9718563 (100%)
  Projection +R1 +R2: 9718563 (100%)
  For variant 0:
    For projection [1, 2]:
      R1:Left position: 0
      R1:Right position: 148
      UMI:Left position: 0
      UMI:Right position: 14
      Variants: 0
      Cost: 0
      R1 length: 148
      UMI length: 14
  ============== RefineTagsAndSort Report ==============
============== RefineTagsAndSort Report ==============
Time spent in correction: 0ns
UMI input diversity: 1250193
UMI output diversity: 1090616 (87.24%)
UMI input reads: 8996138
UMI output count: 8995621 (99.99%)
UMI mean reads per tag: 7.2
UMI input core diversity: 1245586 (99.63%)
UMI input core reads: 8991529 (99.95%)
UMI directly corrected diversity: 159060 (12.72%)
UMI directly corrected reads: 162316 (1.8%)
UMI diversity filtered by tag quality: 517 (0.04%)
UMI reads filtered by tag quality: 517 (0.01%)
UMI diversity filtered by whitelist: 0 (0%)
UMI recursively corrected: 2670
Number of output records: 8250369 (91.71%)
Filter report:
  Number of groups: 1090616
  Number of groups accepted: 790459 (72.48%)
  Total records weight: 8995621.0
  Records weight accepted: 8250369.0 (91.72%)
  Operator #0:
    Effective threshold: 5.0
============== Assemble Report ==============
============== Assemble Report ==============
Number of input groups: 790459
Number of input alignments: 8250369
Number of output pre-clonotypes: 796354
Number of clonotypes per group:
  0: + 10553 (1.34%) = 10553 (1.34%)
  1: + 752646 (95.89%) = 763199 (97.23%)
  2: + 21461 (2.73%) = 784660 (99.97%)
  3: + 262 (0.03%) = 784922 (100%)
Number of core alignments: 7973163 (96.64%)
Discarded core alignments: 205350 (2.58%)
Empirically assigned alignments: 7336 (0.09%)
Empirical assignment conflicts: 13 (0%)
UMI+VJ-gene empirically assigned alignments: 7349 (0.09%)
VJ-gene empirically assigned alignments: 0 (0%)
UMI empirically assigned alignments: 0 (0%)
Number of ambiguous UMIs: 21723
Number of ambiguous V-genes: 610
Number of ambiguous J-genes: 2361
Number of ambiguous UMI+V/J-gene combinations: 2971
Unassigned alignments: 217734 (2.64%)
Final clonotype count: 335571
Average number of reads per clonotype: 23.76
Reads used in clonotypes, percent of total: 7971547 (82.02%)
Reads used in clonotypes before clustering, percent of total: 7975927 (82.07%)
Number of reads used as a core, percent of used: 7975521 (99.99%)
Mapped low quality reads, percent of used: 406 (0.01%)
Reads clustered in PCR error correction, percent of used: 4380 (0.05%)
Reads pre-clustered due to the similar VJC-lists, percent of used: 1734 (0.02%)
Reads dropped due to the lack of a clone sequence, percent of total: 71856 (0.74%)
Reads dropped due to a too short clonal sequence, percent of total: 161 (0%)
Reads dropped due to low quality, percent of total: 0 (0%)
Reads dropped due to failed mapping, percent of total: 4411 (0.05%)
Reads dropped with low quality clones, percent of total: 0 (0%)
Clonotypes eliminated by PCR error correction: 549
Clonotypes dropped as low quality: 0
Clonotypes pre-clustered due to the similar VJC-lists: 128
Clones dropped in post filtering: 0 (0%)
Reads dropped in post filtering: 0.0 (0%)
Alignments filtered by tag prefix: 0 (0%)
TRA chains: 50185 (14.96%)
TRA non-functional: 6876 (13.7%)
TRB chains: 72010 (21.46%)
TRB non-functional: 1704 (2.37%)
TRD chains: 539 (0.16%)
TRD non-functional: 72 (13.36%)
TRG chains: 1917 (0.57%)
TRG non-functional: 992 (51.75%)
IGH chains: 111674 (33.28%)
IGH non-functional: 1424 (1.28%)
IGK chains: 48436 (14.43%)
IGK non-functional: 3316 (6.85%)
IGL chains: 50810 (15.14%)
IGL non-functional: 3503 (6.89%)
{
  "align": {
    "type": "alignerReport",
    "commandLine": "align --report results/Sample1.align.report.txt --json-report results/Sample1.align.report.json --preset local:cellecta-air-cdr3 /raw0/cellecta/Sample1_R1.fastq.gz /raw0/cellecta/Sample1_R2.fastq.gz results/Sample1.vdjca",
    "inputFiles": [
      "/raw0/cellecta/Sample1_R1.fastq.gz",
      "/raw0/cellecta/Sample1_R2.fastq.gz"
    ],
    "outputFiles": [
      "results/Sample1.vdjca"
    ],
    "version": "4.1.0; built=Tue Oct 18 17:33:21 UTC 2022; rev=852d9d8feb; lib=repseqio.v2.0",
    "trimmingReport": null,
    "totalReadsProcessed": 9718563,
    "aligned": 8996138,
    "notAligned": 722425,
    "notAlignedReasons": {
      "NoCDR3Parts": 0,
      "NoHits": 922,
      "NoVHits": 0,
      "NoBarcode": 0,
      "NoJHits": 721503,
      "VAndJOnDifferentTargets": 0,
      "LowTotalScore": 0
    },
    "chimeras": 7,
    "overlapped": 0,
    "alignmentAidedOverlaps": 0,
    "overlappedAligned": 0,
    "overlappedNotAligned": 0,
    "pairedEndAlignmentConflicts": 0,
    "vChimeras": 0,
    "jChimeras": 0,
    "chainUsage": {
      "type": "chainUsage",
      "chimeras": 7,
      "total": 8996138,
      "chains": {
        "TRA": {
          "total": 1318953,
          "nonFunctional": 136353,
          "isOOF": 121473,
          "hasStops": 14880
        },
        "TRB": {
          "total": 2112628,
          "nonFunctional": 49478,
          "isOOF": 28849,
          "hasStops": 20629
        },
        "TRD": {
          "total": 44783,
          "nonFunctional": 2117,
          "isOOF": 1668,
          "hasStops": 449
        },
        "TRG": {
          "total": 151598,
          "nonFunctional": 76265,
          "isOOF": 74066,
          "hasStops": 2199
        },
        "IGH": {
          "total": 1919314,
          "nonFunctional": 45899,
          "isOOF": 15629,
          "hasStops": 30270
        },
        "IGK": {
          "total": 1801988,
          "nonFunctional": 57301,
          "isOOF": 46094,
          "hasStops": 11207
        },
        "IGL": {
          "total": 1646867,
          "nonFunctional": 62120,
          "isOOF": 50213,
          "hasStops": 11907
        }
      }
    },
    "realignedWithForcedNonFloatingBound": 0,
    "realignedWithForcedNonFloatingRightBoundInLeftRead": 0,
    "realignedWithForcedNonFloatingLeftBoundInRightRead": 0,
    "noCDR3PartsAlignments": 486,
    "partialAlignments": 80481,
    "tagParsingReport": {
      "total": 9718563,
      "matched": 9718563,
      "totalBitCost": 0,
      "projections": {
        "1,2": 9718563
      },
      "detailedReport": [
        {
          "nested": {
            "1,2": {
              "variantId": 0,
              "nested": [
                [
                  {
                    "positionDistributions": {
                      "R1:Left": {
                        "0": 9718563
                      },
                      "R1:Right": {
                        "148": 9718563
                      }
                    },
                    "lengthDistributions": {
                      "R1": {
                        "148": 9718563
                      }
                    },
                    "costDistributions": {
                      "0": 9718563
                    },
                    "variantDistribution": {
                      "0": 9718563
                    }
                  }
                ],
                [
                  {
                    "positionDistributions": {
                      "UMI:Left": {
                        "0": 9718563
                      },
                      "UMI:Right": {
                        "14": 9718563
                      }
                    },
                    "lengthDistributions": {
                      "UMI": {
                        "14": 9718563
                      }
                    },
                    "costDistributions": {
                      "0": 9718563
                    },
                    "variantDistribution": {
                      "0": 9718563
                    }
                  }
                ]
              ],
              "costDistributions": {
                "0": 9718563
              }
            }
          }
        }
      ]
    }
  },
  "refineTagsAndSort": {
    "type": "refineTagsAndSort",
    "commandLine": "refineTagsAndSort --report results/Sample1.refine.report.txt --json-report results/Sample1.refine.report.json results/Sample1.vdjca results/Sample1.refined.vdjca",
    "inputFiles": [
      "results/Sample1.vdjca"
    ],
    "outputFiles": [
      "results/Sample1.refined.vdjca"
    ],
    "version": "; built=Sat Nov 12 10:47:36 UTC 2022; rev=1bb0f1fe0c; lib=repseqio.v2.0",
    "correctionReport": {
      "inputRecords": 8996138,
      "outputRecords": 8250369,
      "steps": [
        {
          "tagName": "UMI",
          "inputGroups": 1,
          "inputDiversity": 1250193,
          "inputCount": 8996138,
          "coreDiversity": 1245586,
          "coreCount": 8991529,
          "directlyCorrectedDiversity": 159060,
          "directlyCorrectedCount": 162316,
          "filteredDiversity": 517,
          "filteredCount": 517,
          "recursivelyCorrected": 2670,
          "diversityFilteredByWhitelist": 0,
          "outputDiversity": 1090616,
          "outputCount": 8995621
        }
      ],
      "filterReport": {
        "type": "filter_groups_report",
        "groupingKeys": [
          "UMI"
        ],
        "numberOfGroups": 1090616,
        "numberOfGroupsAccepted": 790459,
        "totalWeight": 8995621,
        "totalWeightAccepted": 8250369,
        "operatorReports": [
          {
            "operatorReport": {
              "type": "generic_hist_report",
              "threshold": 5
            },
            "metricHists": [
              {
                "bins": [
                  {
                    "from": 1,
                    "to": 1.5848931924611136,
                    "weight": 97497
                  },
                  {
                    "from": 1.5848931924611136,
                    "to": 2.51188643150958,
                    "weight": 46831
                  },
                  {
                    "from": 2.51188643150958,
                    "to": 3.981071705534973,
                    "weight": 69223
                  },
                  {
                    "from": 3.981071705534973,
                    "to": 6.309573444801933,
                    "weight": 272496
                  },
                  {
                    "from": 6.309573444801933,
                    "to": 10,
                    "weight": 232107
                  },
                  {
                    "from": 10,
                    "to": 15.848931924611142,
                    "weight": 262978
                  },
                  {
                    "from": 15.848931924611142,
                    "to": 25.11886431509581,
                    "weight": 98543
                  },
                  {
                    "from": 25.11886431509581,
                    "to": 39.810717055349734,
                    "weight": 10554
                  },
                  {
                    "from": 39.810717055349734,
                    "to": 63.09573444801933,
                    "weight": 366
                  },
                  {
                    "from": 63.09573444801933,
                    "to": 100,
                    "weight": 11
                  },
                  {
                    "from": 100,
                    "to": 158.48931924611142,
                    "weight": 3
                  },
                  {
                    "from": 158.48931924611142,
                    "to": 251.18864315095823,
                    "weight": 3
                  },
                  {
                    "from": 251.18864315095823,
                    "to": 398.1071705534973,
                    "weight": 2
                  },
                  {
                    "from": 398.1071705534973,
                    "to": 630.9573444801937,
                    "weight": 1
                  },
                  {
                    "from": 630.9573444801937,
                    "to": 1000,
                    "weight": 0
                  },
                  {
                    "from": 1000,
                    "to": 1584.893192461114,
                    "weight": 0
                  },
                  {
                    "from": 1584.893192461114,
                    "to": 2511.886431509582,
                    "weight": 0
                  },
                  {
                    "from": 2511.886431509582,
                    "to": 3981.0717055349733,
                    "weight": 0
                  },
                  {
                    "from": 3981.0717055349733,
                    "to": 6309.573444801937,
                    "weight": 0
                  },
                  {
                    "from": 6309.573444801937,
                    "to": 10000,
                    "weight": 0
                  },
                  {
                    "from": 10000,
                    "to": 15848.93192461114,
                    "weight": 0
                  },
                  {
                    "from": 15848.93192461114,
                    "to": 25118.864315095823,
                    "weight": 0
                  },
                  {
                    "from": 25118.864315095823,
                    "to": 39810.71705534977,
                    "weight": 0
                  },
                  {
                    "from": 39810.71705534977,
                    "to": 63095.73444801943,
                    "weight": 1
                  }
                ],
                "collectionSpec": {
                  "log": true,
                  "binNumber": 0,
                  "minBinWidth": 0.2,
                  "multiplyWeightByKey": false
                }
              }
            ]
          }
        ]
      }
    }
  },
  "assemble": {
    "type": "assemblerReport",
    "commandLine": "assemble --report results/Sample1.assemble.report.txt --json-report results/Sample1.assemble.report.json results/Sample1.refined.vdjca results/Sample1.clns",
    "inputFiles": [
      "results/Sample1.refined.vdjca"
    ],
    "outputFiles": [
      "results/Sample1.clns"
    ],
    "version": "; built=Sat Nov 12 10:47:36 UTC 2022; rev=1bb0f1fe0c; lib=repseqio.v2.0",
    "preCloneAssemblerReport": {
      "type": "preCloneAssemblerReport",
      "inputGroups": 790459,
      "inputAlignments": 8250369,
      "clonotypes": 796354,
      "clonotypesPerGroup": {
        "0": 10553,
        "1": 752646,
        "2": 21461,
        "3": 262
      },
      "coreAlignments": 7973163,
      "discardedCoreAlignments": 205350,
      "empiricallyAssignedAlignments": 7336,
      "vjEmpiricallyAssignedAlignments": 0,
      "umiEmpiricallyAssignedAlignments": 0,
      "gatEmpiricallyAssignedAlignments": 7349,
      "empiricalAssignmentConflicts": 13,
      "unassignedAlignments": 217734,
      "umiConflicts": 21723,
      "gatConflicts": 2971,
      "geneConflicts": {
        "Variable": 610,
        "Joining": 2361
      },
      "coreClonotypesDroppedByTagSuffix": 0,
      "coreAlignmentsDroppedByTagSuffix": 0
    },
    "totalReadsProcessed": 9718563,
    "initialClonesCreated": 336248,
    "readsDroppedNoTargetSequence": 71856,
    "readsDroppedTooShortClonalSequence": 161,
    "readsDroppedLowQuality": 0,
    "coreReads": 7975521,
    "readsDroppedFailedMapping": 4411,
    "lowQualityRescued": 406,
    "clonesClustered": 549,
    "readsClustered": 4380,
    "clones": 335571,
    "clonesDroppedAsLowQuality": 0,
    "clonesPreClustered": 128,
    "readsPreClustered": 1734,
    "readsInClones": 7971547,
    "readsInClonesBeforeClustering": 7975927,
    "readsDroppedWithLowQualityClones": 0,
    "clonalChainUsage": {
      "type": "chainUsage",
      "chimeras": 0,
      "total": 335571,
      "chains": {
        "TRA": {
          "total": 50185,
          "nonFunctional": 6876,
          "isOOF": 6596,
          "hasStops": 280
        },
        "TRB": {
          "total": 72010,
          "nonFunctional": 1704,
          "isOOF": 1572,
          "hasStops": 132
        },
        "TRD": {
          "total": 539,
          "nonFunctional": 72,
          "isOOF": 67,
          "hasStops": 5
        },
        "TRG": {
          "total": 1917,
          "nonFunctional": 992,
          "isOOF": 965,
          "hasStops": 27
        },
        "IGH": {
          "total": 111674,
          "nonFunctional": 1424,
          "isOOF": 1171,
          "hasStops": 253
        },
        "IGK": {
          "total": 48436,
          "nonFunctional": 3316,
          "isOOF": 3205,
          "hasStops": 111
        },
        "IGL": {
          "total": 50810,
          "nonFunctional": 3503,
          "isOOF": 3362,
          "hasStops": 141
        }
      }
    },
    "clonesFilteredInPostFiltering": 0,
    "readsFilteredInPostFiltering": 0,
    "postFilteringReports": null,
    "alignmentsFilteredByTagPrefix": 0
  }
}