SMARTer Human BCR IgG IgM H/K/L Profiling Sequencing Kit (Takara Bio Inc.)
Here we will discuss how to process BCR cDNA libraries obtained with SMARTer Human BCR IgG IgM H/K/L Profiling Sequencing Kit (Takara Bio Inc.).
Data libraries
This tutorial uses the data from the following publication: The autoimmune signature of hyperinflammatory multisystem inflammatory syndrome in children Rebecca A. Porritt, et al,JCI (2021) doi:10.1172/JCI151520
Library construction was performed using the SMARTer Human BCR IgG IgM H/K/L Profiling Sequencing Kit (Takara Bio Inc.). Up to 50 ng of total RNA per sample was used for reverse transcription, followed by 4 separate PCR amplification reactions for IgG, IgM, IgK, and IgL. A second round of PCR amplified the entire BCR variable region and a small portion of the constant region. After size selection, quantification and fragment analysis of the individual libraries were performed. Individual chains were then pooled and sequenced on the MiSeq (Illumina) using 2 × 300 bp sequencing. Fastq raw data have been deposited in the European Nucleotide Archive (ENA) under accession number PRJEB44566.
Note
FASTQ files have been merged, thus every pair of FASTQ files holds sequences for all chains corresponding to a sample.
On the scheme bellow you can see structure of cDNA library. UMI is located in the first 12 bp of R2.
All data may be downloaded directly from SRA (PRJEB44566) using e.g. SRA Explorer.
Use aria2c for efficient download of the full dataset with the proper filenames:
mkdir -p raw
aria2c -c -s 16 -x 16 -k 1M -j 8 -i download-list.txt
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/003/ERR5952573/ERR5952573_2.fastq.gz
out=raw/FebControl1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/003/ERR5952573/ERR5952573_1.fastq.gz
out=raw/FebControl1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/004/ERR5952574/ERR5952574_1.fastq.gz
out=raw/FebControl2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/004/ERR5952574/ERR5952574_2.fastq.gz
out=raw/FebControl2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/005/ERR5952575/ERR5952575_1.fastq.gz
out=raw/FebControl3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/005/ERR5952575/ERR5952575_2.fastq.gz
out=raw/FebControl3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/006/ERR5952576/ERR5952576_1.fastq.gz
out=raw/FebControl4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/006/ERR5952576/ERR5952576_2.fastq.gz
out=raw/FebControl4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/007/ERR5952577/ERR5952577_1.fastq.gz
out=raw/FebControl5_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/007/ERR5952577/ERR5952577_2.fastq.gz
out=raw/FebControl5_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/008/ERR5952578/ERR5952578_1.fastq.gz
out=raw/FebControl6_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/008/ERR5952578/ERR5952578_2.fastq.gz
out=raw/FebControl6_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/009/ERR5952579/ERR5952579_1.fastq.gz
out=raw/FebControl7_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/009/ERR5952579/ERR5952579_2.fastq.gz
out=raw/FebControl7_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/000/ERR5952580/ERR5952580_1.fastq.gz
out=raw/FebControl8_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/000/ERR5952580/ERR5952580_2.fastq.gz
out=raw/FebControl8_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/001/ERR5952581/ERR5952581_1.fastq.gz
out=raw/FebControl9_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/001/ERR5952581/ERR5952581_2.fastq.gz
out=raw/FebControl9_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/002/ERR5952582/ERR5952582_1.fastq.gz
out=raw/FebControl10_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/002/ERR5952582/ERR5952582_2.fastq.gz
out=raw/FebControl10_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/003/ERR5952583/ERR5952583_1.fastq.gz
out=raw/FebControl11_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/003/ERR5952583/ERR5952583_2.fastq.gz
out=raw/FebControl11_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/004/ERR5952584/ERR5952584_1.fastq.gz
out=raw/FebControl12_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/004/ERR5952584/ERR5952584_2.fastq.gz
out=raw/FebControl12_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/005/ERR5952585/ERR5952585_1.fastq.gz
out=raw/FebControl13_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/005/ERR5952585/ERR5952585_2.fastq.gz
out=raw/FebControl13_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/006/ERR5952586/ERR5952586_1.fastq.gz
out=raw/FebControl14_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/006/ERR5952586/ERR5952586_2.fastq.gz
out=raw/FebControl14_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/007/ERR5952587/ERR5952587_1.fastq.gz
out=raw/FebControl15_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/007/ERR5952587/ERR5952587_2.fastq.gz
out=raw/FebControl15_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/008/ERR5952588/ERR5952588_1.fastq.gz
out=raw/MISC1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/008/ERR5952588/ERR5952588_2.fastq.gz
out=raw/MISC1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/009/ERR5952589/ERR5952589_1.fastq.gz
out=raw/MISC2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/009/ERR5952589/ERR5952589_2.fastq.gz
out=raw/MISC2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/000/ERR5952590/ERR5952590_1.fastq.gz
out=raw/MISC3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/000/ERR5952590/ERR5952590_2.fastq.gz
out=raw/MISC3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/001/ERR5952591/ERR5952591_1.fastq.gz
out=raw/MISC4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/001/ERR5952591/ERR5952591_2.fastq.gz
out=raw/MISC4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/002/ERR5952592/ERR5952592_1.fastq.gz
out=raw/MISC5_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/002/ERR5952592/ERR5952592_2.fastq.gz
out=raw/MISC5_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/003/ERR5952593/ERR5952593_1.fastq.gz
out=raw/MISC6_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/003/ERR5952593/ERR5952593_2.fastq.gz
out=raw/MISC6_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/004/ERR5952594/ERR5952594_1.fastq.gz
out=raw/MISC7_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/004/ERR5952594/ERR5952594_2.fastq.gz
out=raw/MISC7_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/005/ERR5952595/ERR5952595_1.fastq.gz
out=raw/MISC8_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/005/ERR5952595/ERR5952595_2.fastq.gz
out=raw/MISC8_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/006/ERR5952596/ERR5952596_1.fastq.gz
out=raw/MISC9_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/006/ERR5952596/ERR5952596_2.fastq.gz
out=raw/MISC9_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/007/ERR5952597/ERR5952597_1.fastq.gz
out=raw/MISC10_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/007/ERR5952597/ERR5952597_2.fastq.gz
out=raw/MISC10_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/008/ERR5952598/ERR5952598_1.fastq.gz
out=raw/MISC11_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/008/ERR5952598/ERR5952598_2.fastq.gz
out=raw/MISC11_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/009/ERR5952599/ERR5952599_1.fastq.gz
out=raw/MISC12_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/009/ERR5952599/ERR5952599_2.fastq.gz
out=raw/MISC12_R2.fastq.gz
Upstream analysis
MiXCR has a dedicated preset for this protocol, thus analysing the data is as easy as:
shell mixcr analyze takara-human-rna-bcr-umi-smartseq \ raw/FebControl1_R1.fastq.gz \ raw/FebControl1_R2.fastq.gz \ results/FebControl1
Running the command above will generate the following files:
```shell
ls result/
human-readable reports
FebControl1.report
raw alignments (highly compressed binary file)
FebControl1.vdjca
alignments with refined UMI barcode sequences
FebControl1.refined.vdjca
IGH, IGK and IGL CDR3 clonotypes (highly compressed binary file)
FebControl1.clns
IGH, IGK and IGL CDR3 clonotypes exported in tab-delimited txt
FebControl1.clonotypes.IGH.tsv FebControl1.clonotypes.IGK.tsv FebControl1.clonotypes.IGL.tsv ```
While .clns file holds all data and is used for downstream analysis using mixcr postanalisis, the output .txt clonotype table will contain exhaustive information about each clonotype as well:
See first 100 records from FebControl1.clones.IGH.tsv clonotype table
| cloneId | cloneCount | uniqueTagCountUMI | cloneFraction | targetSequences | targetQualities | allVHitsWithScore | allDHitsWithScore | allJHitsWithScore | allCHitsWithScore | allVAlignments | allDAlignments | allJAlignments | allCAlignments | nSeqFR1 | minQualFR1 | nSeqCDR1 | minQualCDR1 | nSeqFR2 | minQualFR2 | nSeqCDR2 | minQualCDR2 | nSeqFR3 | minQualFR3 | nSeqCDR3 | minQualCDR3 | nSeqFR4 | minQualFR4 | aaSeqFR1 | aaSeqCDR1 | aaSeqFR2 | aaSeqCDR2 | aaSeqFR3 | aaSeqCDR3 | aaSeqFR4 | refPoints |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| 0 | 2432 | 97 | 0.00507824 | TGCATGCAAGGTCTACAAACTCCGTACACTTTT | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV2D-28*00(2473) | nan | IGKJ2*00(377.6) | IGKC*00(169) | 276 | 300 | 319 | 0 | 24 | SC286G | 211.0 | nan | 21 | 31 | 59 | 23 | 33 | 100.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | |
| 1 | 1019 | 35 | 0.00212777 | TGTCAGCAATATTATAGTACTCCGTACACTTTT | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV4-1*00(2886) | nan | IGKJ2*00(376.5) | IGKC*00(169.2) | 279 | 302 | 323 | 0 | 23 | 230.0 | nan | 21 | 31 | 59 | 23 | 33 | 100.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 2 | 993 | 41 | 0.00207348 | TGTCAGCAATATTATAGTACTCCGCTCACTTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV4-1*00(2943.3) | nan | IGKJ4*00(389.3) | IGKC*00(169.4) | 279 | 302 | 323 | 0 | 23 | 230.0 | nan | 19 | 30 | 58 | 22 | 33 | 110.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 3 | 937 | 37 | 0.00195654 | TGTCAGCAGTATAATAACTGGCCTCCGTGGACGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV3-15*00(2818.7) | nan | IGKJ1*00(388.4) | IGKC*00(169.4) | 261 | 285 | 305 | 0 | 24 | 240.0 | nan | 19 | 30 | 58 | 25 | 36 | 110.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 4 | 933 | 33 | 0.00194819 | TGTCAGGAGTATAATAGTTGGCCTCCGTGGACGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV3-15*00(2243.3) | nan | IGKJ1*00(331.1) | IGKC*00(169.4) | 261 | 285 | 305 | 0 | 24 | SC267GSA277GSC278T | 153.0 | nan | 19 | 30 | 58 | 25 | 36 | 110.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | |
| 5 | 881 | 30 | 0.00183961 | TGTCAACAGAGTTACAGTACCCCGTACACTTTT | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV1D-39*00(2785.3) | nan | IGKJ2*00(375.3) | IGKC*00(169.2) | 261 | 284 | 305 | 0 | 23 | 230.0 | nan | 21 | 31 | 59 | 23 | 33 | 100.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 6 | 834 | 24 | 0.00174147 | TGTCAATCTTCAGACAGCAGTAGCACTTATGTCATATTT | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV3-25*00(2297.8) | nan | IGLJ2*00(302.5) | IGLC300(137.4),IGLC700(137.4) | 258 | 288 | 310 | 0 | 30 | SA266TSG267TSG279AST281C | 184.0 | nan | 19 | 30 | 58 | 28 | 39 | SG23CSG24ASC29T | 23.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan |
| 7 | 807 | 28 | 0.00168509 | TGTCAGCAGCGTAGCAACTGGCCTCTCACTTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV3-11*00(2638) | nan | IGKJ4*00(366.7) | IGKC*00(169.4) | 261 | 285 | 305 | 0 | 24 | 240.0 | nan | 21 | 30 | 58 | 24 | 33 | 90.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 8 | 801 | 28 | 0.00167256 | TGTGCAGCATGGGATGACAGCCTGAATGGTTGGGTGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV1-44*00(2784.9) | nan | IGLJ3*00(374.6) | IGLC300(143.7),IGLC700(143.7) | 264 | 294 | 316 | 0 | 30 | 300.0 | nan | 20 | 30 | 58 | 29 | 39 | 100.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 9 | 786 | 6 | 0.00164124 | TGTGCGAGAGTGCTGCGGGTAGCTGGAAGAGTACCAGTTGCTATGGACTTTGACTACCGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV1-18*00(2370.4) | IGHD2-2*00(66) | IGHJ4*00(417.3) | IGHG100(121.9),IGHG200(121.9),IGHG400(121.9),IGHGP00(121.9) | 285 | 295 | 316 | 0 | 10 | 100.0 | 44 | 60 | 93 | 29 | 45 | SC52T | 66.0 | 23 | 37 | 68 | 46 | 60 | ST34C | 111.0 | ;;; | nan | nan | nan | nan | |
| 10 | 770 | 20 | 0.00160783 | TGTCAATCAACAGACATCTCTAGTACTTATGTGATCTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV3-25*00(2197.1) | nan | IGLJ2*00(331.2) | IGLC300(140.4),IGLC700(140.4) | 258 | 288 | 310 | 0 | 30 | SG267ASG274TSA276TSG277CSG279A | 155.0 | nan | 19 | 30 | 58 | 28 | 39 | SG24ASA26C | 52.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan |
| 11 | 737 | 4 | 0.00153892 | TGTGCGAGGGGGAGAGAATACCATGGATCGGGGAGTCTCATCTACTTTGACCACTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV4-61*00(1779.1) | IGHD3-10*00(48) | IGHJ4*00(379.6) | IGHG100(121.9),IGHG200(121.9),IGHG400(121.9),IGHGP00(121.9) | 288 | 296 | 319 | 0 | 8 | 80.0 | 35 | 53 | 93 | 18 | 36 | ST38CST43ASA46G | 48.0 | 21 | 37 | 68 | 41 | 57 | ST31C | 131.0 | ;;; | nan | nan | nan | nan | |
| 12 | 712 | 25 | 0.00148672 | TGTCAGCAATATTATAGTACTCCTCTCACTTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV4-1*00(2948.4) | nan | IGKJ4*00(367.7) | IGKC*00(169.1) | 279 | 303 | 323 | 0 | 24 | 240.0 | nan | 21 | 30 | 58 | 24 | 33 | 90.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 13 | 690 | 25 | 0.00144078 | TGTCAGCAGCGTAGCAACTGGCCGCTCACTTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV3-11*00(2769.5) | nan | IGKJ4*00(382.7) | IGKC*00(169.3) | 261 | 284 | 305 | 0 | 23 | 230.0 | nan | 19 | 30 | 58 | 22 | 33 | 110.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 14 | 686 | 7 | 0.00143243 | TGTGCAAAAGATCTTTCTGGGGCCTACGACTACTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV3-74*00(2232) | IGHD7-27*00(30) | IGHJ4*00(399.4) | IGHG100(122.4),IGHG200(122.4),IGHG400(122.4),IGHGP00(122.4) | 285 | 299 | 316 | 0 | 14 | SG292A | 111.0 | 15 | 21 | 33 | 16 | 22 | 30.0 | 28 | 37 | 68 | 27 | 36 | 90.0 | ;;; | nan | nan | nan | nan | ||
| 15 | 664 | 20 | 0.00138649 | TGTGCAGCATGGGATGACAGCCTGAATGGTTGGGTGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV1-44*00(2816.3) | nan | IGLJ3*00(377.9) | IGLC2*00(133.1) | 264 | 294 | 316 | 0 | 30 | 300.0 | nan | 20 | 30 | 58 | 29 | 39 | 100.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 16 | 647 | 26 | 0.001351 | TGTCAGCAGTATAATAACTGGCCTCCGTACACTTTT | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV3-15*00(2734.3) | nan | IGKJ2*00(376.2) | IGKC*00(169.1) | 261 | 285 | 305 | 0 | 24 | 240.0 | nan | 21 | 31 | 59 | 26 | 36 | 100.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 17 | 636 | 20 | 0.00132803 | TGTCAGCAGCGTAGCAACTGGCCTCCGTGGACGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV3-11*00(2764.7) | nan | IGKJ1*00(389.4) | IGKC*00(169.1) | 261 | 285 | 305 | 0 | 24 | 240.0 | nan | 19 | 30 | 58 | 25 | 36 | 110.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 18 | 620 | 7 | 0.00129462 | TGTGCGAGAGATCTGGACTATATGGTTCGGGGAGTTATTATAACGTACAACTATAACTACGGTATGGAGGTCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV1-18*00(2558.3) | IGHD3-10*00(111) | IGHJ6*00(492.4) | IGHG3*00(122.6) | 285 | 299 | 316 | 0 | 14 | 140.0 | 38 | 63 | 93 | 20 | 45 | SA46G | 111.0 | 22 | 52 | 83 | 45 | 75 | ST25ASC30TST31ASC45G | 184.0 | nan | nan | nan | nan | nan | |
| 19 | 602 | 7 | 0.00125703 | TGTGCGAAAGATCTGTGGGGGGAGACTACAAGGAACACCGGTATGGACGTCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV3-30*00(1777.3) | IGHD2-1500(35),IGHD2-200(35),IGHD4-11*00(35) | IGHJ6*00(467.4) | IGHG100(121.6),IGHG200(121.6),IGHG400(121.6),IGHGP00(121.6) | 285 | 299 | 316 | 0 | 14 | 140.0 | 18 | 25 | 93 | 24 | 31 | 35.0;18 | 25 | 93 | 24 | 31 | 35.0;17 | 24 | 48 | 23 | 30 | 35.0 | ||||
| 20 | 593 | 24 | 0.00123824 | TGTCAGCAGTATAATAACTGGCCTCGGACGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV3-15*00(2786.3) | nan | IGKJ1*00(356.4) | IGKC*00(169.2) | 261 | 288 | 305 | 0 | 27 | SA285C | 241.0 | nan | 22 | 30 | 58 | 25 | 33 | 80.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | |
| 21 | 593 | 18 | 0.00123824 | TGTCAGCAGCGTAGCAACTGGCCTCCGCTCACTTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV3-11*00(2777.3) | nan | IGKJ4*00(387) | IGKC*00(169.3) | 261 | 285 | 305 | 0 | 24 | 240.0 | nan | 19 | 30 | 58 | 25 | 36 | 110.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 22 | 590 | 18 | 0.00123197 | TGTCAATCAACAGACAGCAGTAGTACTTATGTACTCTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV3-25*00(2371) | nan | IGLJ200(309.6),IGLJ300(309.6) | IGLC300(140.6),IGLC700(140.6) | 258 | 288 | 310 | 0 | 30 | SG267ASG279A | 242.0 | nan | 27 | 30 | 58 | 36 | 39 | 30.0;27 | 30 | 58 | 36 | 39 | 30.0 | ; | nan | nan | nan | nan | ||
| 23 | 581 | 16 | 0.00121318 | TGCTCAGCGTGGGATAGCAGACTCAATGCTTGGTTGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV10-54*00(2425.4) | nan | IGLJ3*00(293.3) | IGLC300(147.4),IGLC700(147.4) | 264 | 294 | 316 | 0 | 30 | SA272GSC278TSC284ASG289A | 184.0 | nan | 20 | 30 | 58 | 29 | 39 | SG24T | 71.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan |
| 24 | 578 | 3 | 0.00120692 | TGTGCGAAATTCCCGTATAGTAGCCCTGCCGGGTCCCACTTTGACTGCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV3-23*00(2313.1) | IGHD6-2500(38),IGHD1-2600(36),IGHD6-13*00(36) | IGHJ4*00(418.7) | IGHG3*00(122.7) | 285 | 294 | 316 | 0 | 9 | 90.0 | 0 | 11 | 54 | 19 | 29 | DG6 | 38.0;18 | 28 | 60 | 11 | 21 | SG20C | 36.0;23 | 33 | 63 | 14 | 24 | SC29T | 36.0 | |
| 25 | 559 | 5 | 0.00116724 | TGTGCGAAAGCTGGCTACGGTGACAATACAGGGGCAATTGACCGCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV3-23*00(1960) | IGHD4-17*00(51) | IGHJ5*00(312.4) | IGHG100(122.2),IGHG200(122.2),IGHG400(122.2),IGHGP00(122.2) | 285 | 295 | 316 | 0 | 10 | 100.0 | 16 | 29 | 48 | 11 | 24 | SA18G | 51.0 | 31 | 40 | 71 | 39 | 48 | SC35G | 61.0 | ;;; | nan | nan | nan | nan | |
| 26 | 559 | 17 | 0.00116724 | TGCAGCTCATATACAAGCAGCAGCACTCTCGTGGTATTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV2-14*00(2834.5) | nan | IGLJ2*00(362.7) | IGLC300(143.7),IGLC700(143.7) | 267 | 298 | 317 | 0 | 31 | 310.0 | nan | 21 | 30 | 58 | 30 | 39 | 90.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 27 | 553 | 19 | 0.00115472 | TGCCAGTCCTATGACAGCAGCCTGAGTGGTGTGGTATTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV1-40*00(2843.7) | nan | IGLJ2*00(373) | IGLC300(144.5),IGLC700(144.5) | 267 | 297 | 319 | 0 | 30 | 300.0 | nan | 20 | 30 | 58 | 29 | 39 | 100.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 28 | 549 | 4 | 0.00114636 | TGTGCGAGAACCCTCGATATTGCAGCACTTCCAGCTGCTGTTCGGCGGGATGGCTACTTTGACTCCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV4-34*00(2379.4) | IGHD2-2*00(64) | IGHJ4*00(437.7) | IGHG100(121.1),IGHG200(121.1),IGHG400(121.1),IGHGP00(121.1) | 282 | 297 | 313 | 0 | 15 | SG291ASG292C | 92.0 | 33 | 57 | 93 | 15 | 39 | ST40CST43CSG45CSA47T | 64.0 | 21 | 37 | 68 | 53 | 69 | SA32C | 131.0 | ;;; | nan | nan | nan | nan |
| 29 | 547 | 9 | 0.00114219 | TGTGTGAGAGACGGGCCCCCTTACAATTTTGACTACTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV3-33*00(1653.8) | IGHD3-16*00(25) | IGHJ4*00(314.3) | IGHG100(112.7),IGHG200(112.7),IGHG4*00(112.7) | 285 | 296 | 316 | 0 | 11 | SC289T | 81.0 | 15 | 20 | 111 | 15 | 20 | 25.0 | 19 | 37 | 68 | 21 | 39 | ST22ASC24T | 122.0 | ;; | nan | nan | nan | nan | |
| 30 | 543 | 17 | 0.00113383 | TGCTGCTCATATGCAGGTAGTAGCACTTGGGTGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV2-23*00(2834.9) | nan | IGLJ3*00(376.8) | IGLC300(139.6),IGLC700(139.6) | 267 | 295 | 317 | 0 | 28 | 280.0 | nan | 17 | 30 | 58 | 23 | 36 | SA19C | 101.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | |
| 31 | 539 | 17 | 0.00112548 | TGTGCAGCATGGGATGACAGCCTGAGTGGTTGGGTGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV1-47*00(2859.2) | nan | IGLJ3*00(379.1) | IGLC300(144.3),IGLC700(144.3) | 264 | 294 | 316 | 0 | 30 | 300.0 | nan | 20 | 30 | 58 | 29 | 39 | 100.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 32 | 535 | 18 | 0.00111713 | TGCAGCTCATATACAAGCAGCAGCACTTGGGTGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV2-14*00(2830.5) | nan | IGLJ3*00(373.8) | IGLC2*00(140.2) | 267 | 294 | 317 | 0 | 27 | 270.0 | nan | 17 | 30 | 58 | 23 | 36 | SA19C | 101.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | |
| 33 | 534 | 22 | 0.00111504 | TGCATGCAAGCTCTACAAACTCCGTACACTTTT | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV2D-28*00(2763.3) | nan | IGKJ2*00(377.3) | IGKC*00(169.2) | 276 | 300 | 319 | 0 | 24 | 240.0 | nan | 21 | 31 | 59 | 23 | 33 | 100.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 34 | 529 | 3 | 0.0011046 | TGTGCGAGACGGGCTTTACTTCTCTGGTCGTTCGACCTTTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV4-31*00(1992.7) | IGHD6-600(26),IGHD3-1000(25),IGHD6-13*00(25) | IGHJ5*00(381.1) | IGHG100(122.2),IGHG200(122.2),IGHG400(122.2),IGHGP00(122.2) | 288 | 297 | 319 | 0 | 9 | 90.0 | 9 | 17 | 54 | 12 | 20 | SA12T | 26.0;34 | 39 | 93 | 15 | 20 | 25.0;35 | 40 | 63 | 23 | 28 | 25.0 | |||
| 35 | 527 | 22 | 0.00110042 | TGTCAACAGAGTTACAGTACCCCTCTCACTTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV1D-39*00(2856.1) | nan | IGKJ4*00(366.1) | IGKC*00(169.4) | 261 | 285 | 305 | 0 | 24 | 240.0 | nan | 21 | 30 | 58 | 24 | 33 | 90.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 36 | 520 | 6 | 0.00108581 | TGTGCGAGAGACCAACTTAAAGGAAAGAAGTGGGAATTACTTCTGTCCGGTATGGACGTCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV4-61*00(1583.6) | IGHD3-2200(39),IGHD1-2600(37) | IGHJ6*00(410.7) | IGHG100(121.4),IGHG200(121.4),IGHG400(121.4),IGHGP00(121.4) | 288 | 299 | 319 | 0 | 11 | 110.0 | 41 | 60 | 93 | 22 | 41 | ST43AST46AST52GST53A | 39.0;25 | 38 | 60 | 28 | 41 | SG32ASC33T | 37.0 | 36 | 52 | 83 | 47 | 63 | ||
| 37 | 518 | 16 | 0.00108163 | TGTCAATCTTCAGACAGCAGTAGCACTTATGTCATATTT | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV3-25*00(2225.6) | nan | IGLJ2*00(302.4) | IGLC2*00(131.5) | 258 | 288 | 310 | 0 | 30 | SA266TSG267TSG279AST281C | 184.0 | nan | 19 | 30 | 58 | 28 | 39 | SG23CSG24ASC29T | 23.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan |
| 38 | 510 | 17 | 0.00106493 | TGCCAGTCCTATGACAGCAGCCTGAGTGGTTGGGTGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV1-40*00(2837.2) | nan | IGLJ3*00(374.8) | IGLC300(143.7),IGLC700(143.7) | 267 | 298 | 319 | 0 | 31 | 310.0 | nan | 20 | 30 | 58 | 29 | 39 | 100.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 39 | 508 | 14 | 0.00106075 | TGTCAGGCGTGGGACAGCAGCACTGTGGTATTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV3-1*00(2566.3) | nan | IGLJ2*00(378.1) | IGLC300(147.3),IGLC700(147.3) | 258 | 283 | 305 | 0 | 25 | 250.0 | nan | 20 | 30 | 58 | 23 | 33 | 100.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 40 | 506 | 4 | 0.00105657 | TGTGCACGTCCGGGGCTTGGGGTGCGAGCTACTCTCTACTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV2-5*00(2824.2) | IGHD1-26*00(46) | IGHJ4*00(379.1) | IGHG100(121.5),IGHG200(121.5),IGHG400(121.5),IGHGP00(121.5) | 288 | 295 | 321 | 0 | 7 | 70.0 | 26 | 38 | 60 | 21 | 33 | SG29C | 46.0 | 30 | 37 | 68 | 35 | 42 | 70.0 | ;;; | nan | nan | nan | nan | ||
| 41 | 502 | 20 | 0.00104822 | TGCATGCAAGCTCTACAAACTCCGTGGACGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV2D-28*00(2966.6) | nan | IGKJ1*00(389.5) | IGKC*00(169.3) | 276 | 300 | 319 | 0 | 24 | 240.0 | nan | 19 | 30 | 58 | 22 | 33 | 110.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 42 | 499 | 5 | 0.00104196 | TGTGCGAGAGATGATCGTAGGAGTTATTATGAGTATTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV3-7*00(2232) | IGHD3-1000(50),IGHD3-2200(43) | IGHJ4*00(350.1) | IGHG100(120),IGHG200(120),IGHG400(120),IGHGP00(120) | 285 | 297 | 316 | 0 | 12 | 120.0 | 48 | 58 | 93 | 19 | 29 | 50.0;41 | 58 | 93 | 12 | 29 | SA44CST49GSG50A | 43.0 | 27 | 37 | 68 | 29 | 39 | SC30GSC33T | ||
| 43 | 496 | 22 | 0.00103569 | TGCCAGTCCTATGACAGCAGCCTGAGTGGTTATGTCTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV1-40*00(2856.5) | nan | IGLJ1*00(379.1) | IGLC1*00(221.6) | 267 | 298 | 319 | 0 | 31 | 310.0 | nan | 20 | 30 | 58 | 29 | 39 | 100.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 44 | 493 | 23 | 0.00102943 | TGTAACTCCCGGGCCAGTAGTGGGACCTCTTATGTCTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV3-19*00(2014.2) | nan | IGLJ1*00(321.4) | IGLC1*00(220.6) | 258 | 281 | 310 | 0 | 23 | SA271CSC275T | 172.0 | nan | 20 | 30 | 58 | 29 | 39 | 100.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | |
| 45 | 490 | 15 | 0.00102317 | TGTCAATCAGCAGACAGCAGTGGTACTTATGTGGTATTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV3-25*00(2767.4) | nan | IGLJ2*00(388.9) | IGLC300(151.4),IGLC700(151.4) | 258 | 288 | 310 | 0 | 30 | 300.0 | nan | 19 | 30 | 58 | 28 | 39 | 110.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 46 | 490 | 15 | 0.00102317 | TGTCAACAGAGTTACAGTACCCCTCGGACGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV1D-39*00(2866.1) | nan | IGKJ1*00(359) | IGKC*00(169.5) | 261 | 288 | 305 | 0 | 27 | SA285C | 241.0 | nan | 22 | 30 | 58 | 25 | 33 | 80.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | |
| 47 | 488 | 15 | 0.00101899 | TGCAGCTCATATACAAGCAGCAGCACTGTGGTATTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV2-14*00(2836.4) | nan | IGLJ2*00(378.5) | IGLC300(140.8),IGLC700(140.8) | 267 | 294 | 317 | 0 | 27 | 270.0 | nan | 20 | 30 | 58 | 26 | 36 | 100.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 48 | 487 | 3 | 0.0010169 | TGTGCAAGAGATTGGAGTCGGGCTGGTCCCTCAACTATTGACTACTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV3-74*00(2538) | IGHD6-1900(35),IGHD3-1000(31),IGHD6-13*00(30) | IGHJ4*00(418) | IGHG100(121.4),IGHG200(121.4),IGHG400(121.4),IGHGP00(121.4) | 285 | 297 | 316 | 0 | 12 | 120.0 | 33 | 40 | 63 | 20 | 27 | 35.0;11 | 20 | 93 | 26 | 35 | SG16C | 31.0;34 | 40 | 63 | 21 | 27 | 30.0 | |||
| 49 | 479 | 15 | 0.0010002 | TGCCAACAGTATAATAGTTATTGGACGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV1-5*00(2740.7) | nan | IGKJ1*00(368.9) | IGKC*00(169.4) | 261 | 283 | 305 | 0 | 22 | 220.0 | nan | 21 | 30 | 58 | 21 | 30 | 90.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 50 | 471 | 13 | 0.000983492 | TGTGCAGCATGGGATGACAGCCTGAATGGTGTGGTATTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV1-44*00(2725.2) | nan | IGLJ2*00(379.2) | IGLC300(144.1),IGLC700(144.1) | 264 | 294 | 316 | 0 | 30 | 300.0 | nan | 20 | 30 | 58 | 29 | 39 | 100.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 51 | 470 | 16 | 0.000981403 | TGTCAATCAACAGACAGCAGTAGTACTTATGTACTCTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV3-25*00(2368.3) | nan | IGLJ200(309.1),IGLJ300(309) | IGLC2*00(141.2) | 258 | 288 | 310 | 0 | 30 | SG267ASG279A | 242.0 | nan | 27 | 30 | 58 | 36 | 39 | 30.0;27 | 30 | 58 | 36 | 39 | 30.0 | nan | nan | nan | nan | nan | ||
| 52 | 470 | 5 | 0.000981403 | TGTGCGACAAATGACTTCGGTGACATAGCGGCGGGAAGGGGTTTGGACGTCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV1-69D*00(1801.6) | IGHD4-17*00(56) | IGHJ6*00(429) | IGHG100(121.7),IGHG200(121.7),IGHG400(121.7),IGHGP00(121.7) | 285 | 292 | 316 | 0 | 7 | 70.0 | 15 | 29 | 48 | 10 | 24 | SA21T | 56.0 | 37 | 52 | 83 | 39 | 54 | SA40T | 121.0 | ;;; | nan | nan | nan | nan | |
| 53 | 467 | 17 | 0.000975139 | TGTCAACAGAGTTACAGTACCCCTCGAACGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV1D-39*00(2838.7) | nan | IGKJ1*00(336.9) | IGKC*00(169.3) | 261 | 285 | 305 | 0 | 24 | 240.0 | nan | 24 | 30 | 58 | 27 | 33 | 60.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 54 | 465 | 3 | 0.000970963 | TGTGCGAGAACTGCGGGATCTTGTCGCGCTACGTCTTGTCCACCGAACAACTGGTTCGGCCCCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV4-39*00(1865.9) | IGHD7-2700(38),IGHD6-2500(35) | IGHJ5*00(363.8) | IGHG100(121.3),IGHG200(121.3),IGHG400(121.3),IGHGP00(121.3) | 288 | 297 | 319 | 0 | 9 | 90.0 | 14 | 24 | 33 | 9 | 20 | I18C | 38.0;31 | 38 | 54 | 27 | 34 | 35.0 | 20 | 40 | 71 | 46 | 66 | SA32G | ||
| 55 | 457 | 3 | 0.000954258 | TGTGCGAGAAATGACTTCGGTGACATTGCGGCGGGACGGGGTATGGACGTCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV1-69D*00(1768.7) | IGHD4-17*00(46) | IGHJ6*00(429.2) | IGHG100(122.2),IGHG200(122.2),IGHG400(122.2),IGHGP00(122.2) | 285 | 297 | 316 | 0 | 12 | SG294A | 91.0 | 17 | 29 | 48 | 12 | 24 | SA21T | 46.0 | 37 | 52 | 83 | 39 | 54 | 150.0 | ;;; | nan | nan | nan | nan | |
| 56 | 455 | 17 | 0.000950082 | TGTCAGCAGTATAATAACTGGCCTCCGCTCACTTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV3-15*00(2768.3) | nan | IGKJ4*00(387.6) | IGKC*00(169.3) | 261 | 285 | 305 | 0 | 24 | 240.0 | nan | 19 | 30 | 58 | 25 | 36 | 110.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 57 | 454 | 7 | 0.000947994 | TGTGCGATCGGGGCCCGGCCCCACTTCTACTACTACACGGACGTCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV4-59*00(1991.3) | IGHD2-200(25),IGHD6-1300(25),IGHD6-25*00(25) | IGHJ6*00(375.6) | IGHG100(121.6),IGHG200(121.6),IGHG400(121.6),IGHGP00(121.6) | 282 | 289 | 313 | 0 | 7 | 70.0 | 60 | 65 | 93 | 14 | 19 | 25.0;18 | 23 | 63 | 13 | 18 | 25.0;15 | 20 | 54 | 13 | 18 | 25.0 | ||||
| 58 | 447 | 3 | 0.000933377 | TGTGCCTCCTATAGCAGTAGTTGGCATGAGGCTTTTGATATGTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV1-8*00(1984.5) | IGHD6-1300(47),IGHD6-1900(47),IGHD6-25*00(40) | IGHJ3*00(429.2) | IGHG100(121.2),IGHG200(121.2),IGHG400(121.2),IGHGP00(121.2) | 285 | 290 | 316 | 0 | 5 | 50.0 | 24 | 39 | 63 | 9 | 24 | SC32TSC35T | 47.0;24 | 39 | 63 | 9 | 24 | SG33ASC35T | 47.0;21 | 29 | 54 | 9 | 17 | 40.0 | ||
| 59 | 443 | 5 | 0.000925025 | TGTGCGACCAATTACGCTATTTGGAGTGGTTATGAAGTGGCCGATGCTTTTGAGATCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV4-39*00(2019.1) | IGHD3-3*00(87) | IGHJ3*00(427.1) | IGHG100(122.2),IGHG200(122.2),IGHG400(122.2),IGHGP00(122.2) | 288 | 295 | 319 | 0 | 7 | 70.0 | 33 | 56 | 93 | 10 | 33 | SA39CST41A | 87.0 | 21 | 39 | 70 | 42 | 60 | ST32G | 151.0 | ;;; | nan | nan | nan | nan | |
| 60 | 440 | 14 | 0.000918761 | TGTCAATCAGCAGACAGCAGTGGTACTTATGTCTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV3-25*00(2685.2) | nan | IGLJ1*00(369.2) | IGLC1*00(220.6) | 258 | 288 | 310 | 0 | 30 | 300.0 | nan | 17 | 30 | 58 | 23 | 36 | SA19C | 101.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | |
| 61 | 425 | 11 | 0.000887439 | TGCCAGTCCTATGACAGCAGCCTGAGTGCCTCGGTGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV1-40*00(2484.9) | nan | IGLJ3*00(343.7) | IGLC300(142.2),IGLC700(142.2) | 267 | 295 | 319 | 0 | 28 | 280.0 | nan | 23 | 30 | 58 | 32 | 39 | 70.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 62 | 424 | 2 | 0.000885351 | TGTGCGAGGGGGTCGGGGAAAAACTACTTTGACTCCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV4-39*00(2219.4) | IGHD3-1600(25),IGHD7-2700(25) | IGHJ4*00(419.1) | IGHG100(122.5),IGHG200(122.5),IGHG400(122.5),IGHGP00(122.5) | 288 | 296 | 319 | 0 | 8 | 80.0 | 55 | 60 | 111 | 14 | 19 | 25.0;17 | 22 | 33 | 14 | 19 | 25.0 | 20 | 37 | 68 | 22 | 39 | SA32C | |||
| 63 | 423 | 5 | 0.000883263 | TGTGCGAGAGAAGTCGGTCCTAAGGTTCGGGGAGTTATTATAACGCCAAACTGGTACGACGCCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV7-4-1*00(2355.2) | IGHD3-10*00(102) | IGHJ5*00(429.4) | IGHG100(119.8),IGHG200(119.8),IGHG400(119.8),IGHGP00(119.8) | 285 | 296 | 316 | 0 | 11 | 110.0 | 37 | 63 | 93 | 19 | 45 | ST40ASA46G | 102.0 | 22 | 40 | 71 | 48 | 66 | ST29ASC34G | 122.0 | ;;; | nan | nan | nan | nan | |
| 64 | 422 | 5 | 0.000881175 | TGTGCGAGATGGGCGGGGGCATTCCAATGGTTAAAACCTCTTGACTACTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV7-4-1*00(2350.8) | IGHD5-500(35),IGHD3-1000(32),IGHD3-3*00(30) | IGHJ4*00(331.6) | IGHG100(123.5),IGHG200(123.5),IGHG400(123.5),IGHGP00(123.5) | 285 | 294 | 316 | 0 | 9 | 90.0 | 32 | 39 | 60 | 26 | 33 | 35.0;33 | 45 | 93 | 20 | 32 | SA36CST38A | 32.0;49 | 55 | 93 | 27 | 33 | 30.0 | |||
| 65 | 418 | 2 | 0.000872823 | TGTGCCTCTTATGGTTCGGCGAGTTATTACTGGTTCGACCCCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV2-5*00(2331.4) | IGHD3-10*00(67) | IGHJ5*00(479.6) | IGHG100(121.2),IGHG200(121.2),IGHG400(121.2),IGHGP00(121.2) | 288 | 293 | 321 | 0 | 5 | 50.0 | 38 | 57 | 93 | 9 | 28 | SA46GSG48C | 67.0 | 23 | 40 | 71 | 28 | 45 | 170.0 | ;;; | nan | nan | nan | nan | ||
| 66 | 416 | 12 | 0.000868646 | TGTCAATCTTCAGACAGCAGTAGCACTTATGTCATATTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV3-25*00(2301.8) | nan | IGLJ2*00(330.6) | IGLC300(133.5),IGLC700(133.5) | 258 | 288 | 310 | 0 | 30 | SA266TSG267TSG279AST281C | 184.0 | nan | 19 | 30 | 58 | 28 | 39 | SG23CSG24A | 52.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan |
| 67 | 414 | 15 | 0.00086447 | TGTCAACAGGCTAACAGTTTCCCTCTCACTTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV1D-12*00(2676) | nan | IGKJ4*00(355.1) | IGKC*00(169.2) | 261 | 285 | 305 | 0 | 24 | 240.0 | nan | 21 | 30 | 58 | 24 | 33 | 90.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 68 | 410 | 14 | 0.000856118 | TGCAGCTCATATACAAGCAGCAGCACTTGGGTGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV2-14*00(2828.1) | nan | IGLJ3*00(374.2) | IGLC300(141.1),IGLC700(141.1) | 267 | 294 | 317 | 0 | 27 | 270.0 | nan | 17 | 30 | 58 | 23 | 36 | SA19C | 101.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | |
| 69 | 401 | 5 | 0.000837325 | TGTGTGAAAGATTATCCACGACCTTTGAGGGGGTTCCCCGGCGCGCCGGTTGACTACTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV3-23*00(1117.4) | IGHD5-1200(40),IGHD5-500(40),IGHD7-27*00(36) | IGHJ4*00(419.1) | IGHG100(122.7),IGHG200(122.2),IGHG4*00(122.2) | 285 | 297 | 316 | 0 | 12 | SC289T | 91.0 | 16 | 24 | 69 | 12 | 20 | 40.0;13 | 21 | 60 | 12 | 20 | 40.0;17 | 27 | 33 | 29 | 39 | SA21T | 36.0 | ||
| 70 | 400 | 15 | 0.000835237 | TGTCAACAGTATAGAAGTGTCCCGTACACTTTT | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV1-3300(2020),IGKV1D-3300(2020) | nan | IGKJ2*00(350.7) | IGKC*00(169.3) | 261 | 273 | 305 | 0 | 12 | 120.0;261 | 273 | 305 | 0 | 12 | 120.0 | nan | 21 | 31 | 59 | 23 | 33 | 100.0 | nan | nan | nan | nan | nan | |||
| 71 | 397 | 15 | 0.000828973 | TGCATGCAAGGTCTACAAACTCCGTACACCTTT | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV2D-28*00(2328) | nan | IGKJ2*00(324.6) | IGKC*00(169.4) | 276 | 300 | 319 | 0 | 24 | SC286G | 211.0 | nan | 21 | 31 | 59 | 23 | 33 | ST27C | 71.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan |
| 72 | 389 | 8 | 0.000812268 | TGCCAGTCCTTTGATCGCAGCCTGAGTGGTTGGGTGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV1-40*00(2466) | nan | IGLJ3*00(292.5) | IGLC300(146.1),IGLC700(146.1) | 267 | 298 | 319 | 0 | 31 | SA277TSC281TSA282C | 223.0 | nan | 20 | 30 | 58 | 29 | 39 | 100.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | |
| 73 | 386 | 6 | 0.000806004 | TGTGCAGCATGGGATGACAGCCTGAGTGGTGTGGTGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV1-47*00(2655.2) | nan | IGLJ3*00(233.6) | IGLC2*00(132.6) | 264 | 294 | 316 | 0 | 30 | 300.0 | nan | 23 | 30 | 58 | 32 | 39 | 70.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 74 | 377 | 12 | 0.000787211 | TGTCAGCAGTATGGTAGCTCACCGTACACTTTT | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV3-20*00(2771.2) | nan | IGKJ2*00(371.9) | IGKC*00(169.1) | 264 | 287 | 308 | 0 | 23 | 230.0 | nan | 21 | 31 | 59 | 23 | 33 | 100.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 75 | 364 | 12 | 0.000760066 | TGCATGCAAGCTCTACAAACTCCGCTCACTTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV2D-28*00(2918.5) | nan | IGKJ4*00(388.6) | IGKC*00(169.5) | 276 | 300 | 319 | 0 | 24 | 240.0 | nan | 19 | 30 | 58 | 22 | 33 | 110.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 76 | 363 | 11 | 0.000757978 | TGTCAACAGAGTTACAGTACCCCGCTCACTTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV1D-39*00(2870.1) | nan | IGKJ4*00(388.4) | IGKC*00(168.9) | 261 | 284 | 305 | 0 | 23 | 230.0 | nan | 19 | 30 | 58 | 22 | 33 | 110.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 77 | 360 | 11 | 0.000751713 | TGTCAGCAGTATGGTAGCTCACCGTGGACGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV3-20*00(2826.6) | nan | IGKJ1*00(389) | IGKC*00(169.2) | 264 | 287 | 308 | 0 | 23 | 230.0 | nan | 19 | 30 | 58 | 22 | 33 | 110.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 78 | 358 | 12 | 0.000747537 | TGTCAGCAGTATAATAACTGGCCTCGAACGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV3-15*00(2753.2) | nan | IGKJ1*00(325.2) | IGKC*00(169) | 261 | 285 | 305 | 0 | 24 | 240.0 | nan | 24 | 30 | 58 | 27 | 33 | 60.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 79 | 355 | 3 | 0.000741273 | TGTATAAAAGACCAATATGGCCCAGAGGACTACTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV3-74*00(1776) | IGHD2-2100(35),IGHD2-1500(30),IGHD2-2*00(30) | IGHJ4*00(330.1) | IGHG100(120),IGHG200(120),IGHG400(120),IGHGP00(120) | 285 | 288 | 316 | 0 | 3 | 30.0 | 19 | 26 | 84 | 12 | 19 | 35.0;22 | 28 | 93 | 12 | 18 | 30.0;22 | 28 | 93 | 12 | 18 | 30.0 | ||||
| 80 | 355 | 15 | 0.000741273 | TGCTGCTCATATGCAGGTAGTAGCACTTATGTCTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV2-23*00(2812.9) | nan | IGLJ1*00(379) | IGLC1*00(221.2) | 267 | 295 | 317 | 0 | 28 | 280.0 | nan | 20 | 30 | 58 | 26 | 36 | 100.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 81 | 354 | 12 | 0.000739185 | TGTCAATCTTCAGACAGCACTAGTACTTATGTCATCTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV3-25*00(1973.5) | nan | IGLJ2*00(309) | IGLC300(142.5),IGLC700(142.5) | 258 | 288 | 310 | 0 | 30 | SA266TSG267TSG277CSG279A | 184.0 | nan | 27 | 30 | 58 | 36 | 39 | 30.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | |
| 82 | 350 | 3 | 0.000730832 | TGTGCGAGAGAGACACTGGGAGGTACGAAGTGGTTCGACCTTTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV1-2*00(2379.4) | IGHD1-26*00(36) | IGHJ5*00(401.1) | IGHG100(122.5),IGHG200(122.5),IGHG400(122.5),IGHGP00(122.5) | 285 | 296 | 316 | 0 | 11 | 110.0 | 27 | 37 | 60 | 16 | 26 | SC33G | 36.0 | 22 | 40 | 71 | 27 | 45 | SC24GSC35TSC36T | 93.0 | ;;; | nan | nan | nan | nan | |
| 83 | 348 | 10 | 0.000726656 | TGCATGCAAGGGACACACTGGCCTTACACTTTT | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV2-3000(2680),IGKV2D-3000(2654.8) | nan | IGKJ2*00(360) | IGKC*00(168.8) | 276 | 300 | 320 | 0 | 24 | ST287G | 211.0;276 | 300 | 320 | 0 | 24 | ST287G | 211.0 | nan | 22 | 31 | 59 | 24 | 33 | 90.0 | nan | nan | nan | nan | nan | |
| 84 | 347 | 8 | 0.000724568 | TGTCAACAGTATAGAAGTGTCCCGTACACTTTT | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV1D-33*00(2042.8) | nan | IGKJ2*00(349.4) | IGKC*00(169.4) | 261 | 273 | 305 | 0 | 12 | 120.0 | nan | 21 | 31 | 59 | 23 | 33 | 100.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 85 | 344 | 14 | 0.000718304 | TGTCAGCAGCGTAGCAACTGGCCTCCGATCACCTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV3-11*00(2798.8) | nan | IGKJ5*00(387.1) | IGKC*00(169.3) | 261 | 285 | 305 | 0 | 24 | 240.0 | nan | 19 | 30 | 58 | 25 | 36 | 110.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 86 | 344 | 12 | 0.000718304 | TGTCAGCAATATTATATTGCTCCTCCAACTTTT | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV4-1*00(2672.5) | nan | IGKJ2*00(339.2) | IGKC*00(169.2) | 279 | 303 | 323 | 0 | 24 | SG295TSA297G | 182.0 | nan | 25 | 31 | 59 | 27 | 33 | 60.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | |
| 87 | 344 | 10 | 0.000718304 | TGTCAATCAACAGACATCTCTAGTACTTATGTGATCTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV3-25*00(2267.3) | nan | IGLJ2*00(331.4) | IGLC2*00(141.5) | 258 | 288 | 310 | 0 | 30 | SG267ASG274TSA276TSG277CSG279A | 155.0 | nan | 19 | 30 | 58 | 28 | 39 | SG24ASA26C | 52.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan |
| 88 | 342 | 9 | 0.000714128 | TGCCAACAGTATAATAGTTACCCGTGGACGTTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV1-5*00(2734.5) | nan | IGKJ1*00(389.6) | IGKC*00(168.7) | 261 | 281 | 305 | 0 | 20 | 200.0 | nan | 19 | 30 | 58 | 22 | 33 | 110.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 89 | 342 | 13 | 0.000714128 | TGCATGCAAGGTACACACTGGCCTCCGTACACTTTT | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGKV2D-30*00(2897.6) | nan | IGKJ2*00(379.2) | IGKC*00(169.3) | 276 | 300 | 320 | 0 | 24 | 240.0 | nan | 21 | 31 | 59 | 26 | 36 | 100.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 90 | 338 | 2 | 0.000705775 | TGTGCGAGAGAGATGTACGGCATGGACGTCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV3-53*00(1923.8) | nan | IGHJ6*00(458.1) | IGHG3*00(123.2) | 282 | 293 | 313 | 0 | 11 | 110.0 | nan | 34 | 52 | 83 | 15 | 33 | ST39C | 151.0 | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | |
| 91 | 335 | 2 | 0.000699511 | TGTGCGAGAAATGACTTCGGTGACATTACGGCGGGCCGGGGTATGGACGTCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV1-69D*00(2039.6) | IGHD4-17*00(46) | IGHJ6*00(458.4) | IGHG100(122.1),IGHG200(122.1),IGHG400(122.1),IGHGP00(121.8) | 285 | 297 | 316 | 0 | 12 | SG294A | 91.0 | 17 | 29 | 48 | 12 | 24 | SA21T | 46.0 | 37 | 52 | 83 | 39 | 54 | 150.0 | ;;; | nan | nan | nan | nan | |
| 92 | 333 | 1 | 0.000695335 | TGTGCGAGATCGATTTTGGAGTGGTATCCCCTGGACTACTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV4-34*00(2138.6) | IGHD3-3*00(63) | IGHJ4*00(370.5) | IGHG3*00(121.8) | 282 | 291 | 313 | 0 | 9 | 90.0 | 37 | 53 | 93 | 10 | 25 | DT40 | 63.0 | 28 | 37 | 68 | 33 | 42 | 90.0 | nan | nan | nan | nan | nan | ||
| 93 | 330 | 4 | 0.000689071 | TGTGCAAAAGGTCTAGGCGAACACTTCTTTGACTCATGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV3-43*00(2123.6) | IGHD2-1500(25),IGHD2-200(25),IGHD2-8*00(25) | IGHJ4*00(360.8) | IGHG100(121.7),IGHG200(121.7),IGHG400(121.7),IGHGP00(121.7) | 285 | 295 | 318 | 0 | 10 | 100.0 | 29 | 34 | 93 | 12 | 17 | 25.0;29 | 34 | 93 | 12 | 17 | 25.0;29 | 34 | 93 | 12 | 17 | 25.0 | ||||
| 94 | 329 | 2 | 0.000686982 | TGTGCGAGCCCTATGCAGGAGGGGCCCCCCTTCCCATTTGACTCCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV4-39*00(2245.3) | IGHD2-2*00(31) | IGHJ4*00(340.5) | IGHG100(122),IGHG200(122),IGHG400(122),IGHGP00(122) | 288 | 296 | 319 | 0 | 8 | 80.0 | 55 | 64 | 93 | 10 | 19 | SC61A | 31.0 | 25 | 37 | 68 | 36 | 48 | SA32C | 91.0 | ;;; | nan | nan | nan | nan | |
| 95 | 327 | 2 | 0.000682806 | TGTGCTAGACAATCTGGAGCTGCTTTTGACTGCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV3-72*00(2331.4) | IGHD6-600(40),IGHD2-1500(38),IGHD6-13*00(35) | IGHJ4*00(397.8) | IGHG100(121.6),IGHG200(121.6),IGHG400(121.6),IGHGP00(121.6) | 291 | 300 | 322 | 0 | 9 | 90.0 | 4 | 12 | 54 | 16 | 24 | 40.0;46 | 57 | 93 | 14 | 24 | DT49 | 38.0;5 | 12 | 63 | 17 | 24 | 35.0 | |||
| 96 | 327 | 3 | 0.000682806 | TGTGCGAGAGGTCGCGATTACTATTTCACTGATGGTTCTTACTCCAAGGACCACTTTGACTCCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV4-61*00(1860.3) | IGHD3-2200(41),IGHD5-1800(41),IGHD3-10*00(40) | IGHJ4*00(278.1) | IGHG100(122.3),IGHG200(122.3),IGHG400(122.3),IGHGP00(122.3) | 288 | 301 | 319 | 0 | 13 | SA298G | 101.0 | 49 | 60 | 93 | 32 | 43 | SA54C | 41.0;12 | 27 | 69 | 19 | 32 | DA17DG23 | 41.0;33 | 41 | 93 | 16 | 24 | 40.0 | |
| 97 | 325 | 8 | 0.00067863 | TGTAACTCCCGGGACAGCAGTGGTAACCATGTGGTATTC | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGLV3-19*00(2759.3) | nan | IGLJ2*00(398.8) | IGLC300(148.2),IGLC700(148.2) | 258 | 288 | 310 | 0 | 30 | 300.0 | nan | 18 | 30 | 58 | 27 | 39 | 120.0 | ; | nan | nan | nan | nan | nan | nan | nan | nan | nan | nan | ||
| 98 | 324 | 4 | 0.000676542 | TGTGCACGGAGTACCGAACCACATTATAATTCAAACTTTGACTTCTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV2-70*00(1892.4) | IGHD1-1400(38),IGHD3-1000(36),IGHD3-9*00(36) | IGHJ4*00(359.9) | IGHG100(122),IGHG200(122),IGHG400(122),IGHGP00(122) | 288 | 298 | 321 | 0 | 10 | 100.0 | 23 | 34 | 51 | 12 | 22 | DG26 | 38.0;60 | 70 | 93 | 20 | 30 | SG62A | 36.0;60 | 70 | 93 | 20 | 30 | SG62A | 36.0 | |
| 99 | 322 | 3 | 0.000672366 | TGTGCGAGAGAATGGATGGGGGATCGCTATCTTGACTACTGG | NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN | IGHV1-69D*00(2437.3) | IGHD3-1600(35),IGHD7-2700(35),IGHD2-21*00(32) | IGHJ4*00(330.6) | IGHG100(123.4),IGHG200(123.4),IGHG400(123.4),IGHGP00(123.4) | 285 | 296 | 316 | 0 | 11 | 110.0 | 53 | 60 | 111 | 16 | 23 | 35.0;17 | 24 | 33 | 18 | 25 | 35.0;41 | 53 | 84 | 18 | 30 | ST43GST47C | 32.0 |
In order to run the analysis for all samples in the project on Linux we can use GNU Parallel in the following way:
```shell
!/usr/bin/env bash
mkdir -p results
ls /raw/R1 | parallel -j 2 --line-buffer \ "mixcr analyze takara-human-rna-bcr-umi-smartseq \ {} \ {=s:R1:R2:=} \ {=s:./:results/:;s:_R.::=}" ```
Under the hood pipeline:
Under the hood the command above actually executes the following pipeline:
align
Alignment of raw sequencing reads against reference database of V-, D-, J- and C- gene segments.
shell mixcr align \ --species hsa \ -p generic-amplicon-with-umi \ -OvParameters.geneFeatureToAlign="VTranscriptWithout5UTRWithP" \ -OvParameters.parameters.floatingLeftBound=false \ -OjParameters.parameters.floatingRightBound=false \ -OсParameters.parameters.floatingRightBound=true \ --tag-pattern "^N{7}(R1:*) \ ^(UMI:N{12})N{4}(R2:*)" \ --report results/FebControl1.report.txt \ --json-report results/FebControl1.report.json \ raw/FebControl1_R1.fastq.gz \ raw/FebControl1_R2.fastq.gz \ results/FebControl1.vdjca
Option --report is specified here explicitly.
--species hsa- determines the organism species (hsa for Homo Sapiens).
-p generic-amplicon-with-umi- a default preset of MiXCR parameters for amplicon data with UMIs.
-OvParameters.geneFeatureToAlign="VTranscriptWithout5UTRWithP"- Sets a V gene feature to align. Check gene features for more info.
-OvParameters.parameters.floatingLeftBound=false- Results in a global alignment algorithm for V gene left bound. We use it because we don't have any primers covering V gene coding sequence.
-OjParameters.parameters.floatingRightBound=false- Results in a global alignment algorithm for J gene right bound, because reverse primers are located in C-gene region.
-OcParameters.parameters.floatingRightBound=true- Results in a local alignment algorithm for C gene right bound, because reverse primers are located in C-gene region.
--tagPattern "^N{7}(R1:*) \ ^(UMI:N{12})N{4}(R2:*)"- tag pattern specifies the location of the UMI barcode and also trims N nucleotides on the 5' end of R1 according to the library structure.
refineTagsAndSort
Corrects sequencing and PCR errors inside barcode sequences. This step does extremely important job by correcting artificial diversity caused by errors in barcodes. In the considered example project it corrects only sequences of UMIs.
shell mixcr refineTagsAndSort \ --report results/FebControl1.report.txt \ --json-report results/FebControl1.report.json \ results/FebControl1.vdjca \ results/FebControl1.refined.vdjca
assemble
Assembles alignments into clonotypes and applies several layers of errors correction:
- quality-dependent correction for sequencing errors
- PCR-error correction by clustering
- UMI-based error correction)
Check mixcr assemble for more information.
shell mixcr assemble \ -OassemblingFeatures="CDR3" -OseparateByJ=true \ -OseparateByV=true \ -OseparateByC=true \ --report results/FebControl1.report.txt \ --json-report results/FebControl1.report.json \ results/FebControl1.refined.vdjca \ results/FebControl1.clns
Options --report and --json-report are specified here explicitly so that the report files will be appended with assembly report.
-OassemblingFeatures=CDR3- By default
takara-hsa-bcr-cdr3preset assembles clones byCDR3sequence. -separateByJ: true- Separate clones with the same assembling feature, but different V-genes.
-separateByV: true- Separate clones with the same assembling feature, but different J-genes.
-separateByC: true- Separate clones with the same assembling feature, but different C-genes. In this case the protocol utilizes sequence-specific primers that allow to separate IgG and IgM isotypes.
export
Exports clonotypes from .clns file into human-readable tables.
shell mixcr exportClones \ -c TRA \ results/S_s.clns \ results/S_s.clonotypes.TRA.txt
-с IGH- defines a specific chain to be exported.
-uniqueTagCount UMI- adds a column with the number of UMIs for each clone.
Quality control
Now when we have all files processed lets perform Quality Control. That can be easily done using mixcr exportQc function.
shell mixcr exportQc align results/*.clns figs/alignQc.pdf
The plot above demonstrates a high quality alignment rate. Nevertheless, about 10% of reads did not align to the reference. MiXCR provides a convenient way to extract not aligned reads and investigate their origin.
By default, MiXCR removed non target reads during alignment. We will realign reads for one of the samples (e.g. MISC9) and extract not aligned reads (--not-aligned-R1, --not-aligned-R2) to separate FASTQ files for manual inspection. See mixcr align for more details.
Bellow is the complete command:
```shell mkdir -p debug
mixcr align \ --species hsa \ -p bundle-umi-kaligner2-v1-base \ -OvParameters.geneFeatureToAlign="VTranscriptWithout5UTRWithP" \ -OvParameters.parameters.floatingLeftBound=false \ -OjParameters.parameters.floatingRightBound=false \ -OcParameters.parameters.floatingRightBound=true \ --tag-pattern "^N{7}(R1:) ^(UMI:N{12})N{4}(R2:)" \ --not-aligned-R1 debug/MISC9_notAligned_R1.fastq \ --not-aligned-R2 debug/MISC9_notAligned_R2.fastq \ --report debug/MISC9.report.txt \ --json-report debug/MISC9.report.json \ raw/MISC9_R1.fastq.gz \ raw/MISC9_R2.fastq.gz \ debug/MISC9.vdjca ```
Resulting MISC9_notAligned_R1.fastq and MISC9_notAligned_R2.fastq files can be manually inspected. A brief BLAST search revealed most not aligned sequences come from DNA sequence (in between gene segments or from immunoglobulin like genes (e.g.IGLL5) )
Now Lets look at the chain distribution in every sample.
shell mixcr exportQc chainUsage results/*.clns figs/chainUsage.pdf
We see that in most sample number of light chains significantly dominate over IGH. Since libraries for all chains were generated in a separate PCR reactions according to the protocol, we might suggest that this bias arise from unequal mixing of cDNA libraries prior sequencing.
Full-length clonotype assembly
SMARTer Human BCR IgG IgM H/K/L Profiling Sequencing Kit allows to recover a broader BCR receptor sequence then just CDR3 region. Since this protocol is based on 5'RACE method, the full V-gene sequence should present. Reverse sequence specific primers are located in C-gene region providing enough sequence for IgG\IgM isotype identification.
Taking into account what is mentioned above, the longest possible assembling feature for this protocol is VDJRegion.
MiXCR has a specific preset to obtain full-length BCR clones with SMARTer Human BCR IgG IgM H/K/L Profiling Sequencing Kit:
shell mixcr analyze takara-human-rna-bcr-umi-smartseq \ raw/FebControl1_R1.fastq.gz \ raw/FebControl1_R2.fastq.gz \ results/FebControl1
The mixcr assemble step in this preset differs from the one above in the following manner:
shell mixcr assemble \ -OassemblingFeatures="VDJRegion" \ -OseparateByC=true \ --report results/FebControl1.report.txt \ --json-report results/FebControl1.report.json \ results/FebControl1.refined.vdjca \ results/FebControl1.clns
-OassemblingFeatures="VDJRegion"- sets the assembling feature to the region which starts from
FR1Beginand ends at the end ofFR4.
Notice that we do not use -OseparateByV=true and -OseparateByJ=true in this case because assembling feature already covers full V and J sequences, thus in case if clones have identical CDR3 they will still be separated. We still use -OseparateByC=true option for isotype identification.
Reports
Finally, MiXCR provides a very convenient way to look at the reports generated at ech step. Every .vdjca, .clns and .clna file holds all the reports for every MiXCR function that has been applied to this sample. E.g. in our case .clns file contains reports for mixcr align and mixcr assemble. To output this report use mixcr exportReports as shown bellow. Note --json parameter will output a JSON-formatted report.
shell mixcr exportReports \ results/FebControl1.clns \ results/FebControl1.report.txt
shell mixcr exportReports \ --json \ results/FebControl1.clns \ results/FebControl1.report.json
Show report file
shell ============== Align Report ============== Input file(s): /raw/PRJEB44566_takara_hsa_bcr/FebControl1_R1.fastq.gz,/raw/PRJEB44566_takara_hsa_bcr/FebControl1_R2.fastq.gz Output file(s): results/FebControl1.vdjca Version: ; built=Mon Sep 26 10:55:18 CEST 2022; rev=8c998df1ab; lib=repseqio.v2.0 Command line arguments: --report results/FebControl1.align.report.txt --json-report results/FebControl1.align.report.json --preset local:takara-smarter-human-bcr-cdr3 /raw/PRJEB44566_takara_hsa_bcr/FebControl1_R1.fastq.gz /raw/PRJEB44566_takara_hsa_bcr/FebControl1_R2.fastq.gz results/FebControl1.vdjca Analysis time: 0ns Total sequencing reads: 584053 Successfully aligned reads: 525390 (89.96%) Paired-end alignment conflicts eliminated: 42139 (7.21%) Alignment failed, no hits (not TCR/IG?): 49276 (8.44%) Alignment failed because of absence of V hits: 2982 (0.51%) Alignment failed because of absence of J hits: 6044 (1.03%) No target with both V and J alignments: 361 (0.06%) Overlapped: 509629 (87.26%) Overlapped and aligned: 466857 (79.93%) Alignment-aided overlaps: 22223 (4.76%) Overlapped and not aligned: 42772 (7.32%) No CDR3 parts alignments, percent of successfully aligned: 89 (0.02%) Partial aligned reads, percent of successfully aligned: 2659 (0.51%) V gene chimeras: 1154 (0.2%) J gene chimeras: 2 (0%) IGH chains: 116697 (22.21%) IGH non-functional: 3925 (3.36%) IGK chains: 203474 (38.73%) IGK non-functional: 8958 (4.4%) IGL chains: 205219 (39.06%) IGL non-functional: 11257 (5.49%) Realigned with forced non-floating bound: 193294 (33.1%) Realigned with forced non-floating right bound in left read: 52153 (8.93%) Realigned with forced non-floating left bound in right read: 52153 (8.93%) ============== RefineTagsAndSort Report ============== Input file(s): results/FebControl1.vdjca Output file(s): results/FebControl1.refined.vdjca Version: ; built=Mon Sep 26 10:55:18 CEST 2022; rev=8c998df1ab; lib=repseqio.v2.0 Command line arguments: --report results/FebControl1.refine.report.txt --json-report results/FebControl1.refine.report.json results/FebControl1.vdjca results/FebControl1.refined.vdjca Analysis time: 0ns Time spent in correction: 0ns UMI input diversity: 60939 UMI output diversity: 41866 (68.7%) UMI input reads: 525390 UMI output count: 522239 (99.4%) UMI mean reads per tag: 8.62 UMI input core diversity: 48831 (80.13%) UMI input core reads: 513049 (97.65%) UMI directly corrected diversity: 15939 (26.16%) UMI directly corrected reads: 16711 (3.18%) UMI diversity filtered by tag quality: 3134 (5.14%) UMI reads filtered by tag quality: 3151 (0.6%) UMI diversity filtered by whitelist: 0 (0%) UMI recursively corrected: 878 Number of output records: 487187 (92.73%) Filter report: Number of groups: 41866 Number of groups accepted: 15113 (36.1%) Total records weight: 522239.0 Records weight accepted: 487187.0 (93.29%) Operator #0: Effective threshold: 6.0 ============== Assemble Report ============== Input file(s): results/FebControl1.refined.vdjca Output file(s): results/FebControl1.clns Version: ; built=Mon Sep 26 10:55:18 CEST 2022; rev=8c998df1ab; lib=repseqio.v2.0 Command line arguments: --report results/FebControl1.assemble.report.txt --json-report results/FebControl1.assemble.report.json results/FebControl1.refined.vdjca results/FebControl1.clns Analysis time: 0ns Number of input groups: 15113 Number of input alignments: 487187 Number of output pre-clonotypes: 14993 Number of clonotypes per group: 0: + 89 (0.59%) = 89 (0.59%) 1: + 14965 (99.32%) = 15054 (99.91%) 2: + 14 (0.09%) = 15068 (100%) Number of core alignments: 474527 (97.4%) Discarded core alignments: 4683 (0.99%) Empirically assigned alignments: 5590 (1.15%) Empirical assignment conflicts: 0 (0%) UMI+VJ-gene empirically assigned alignments: 5590 (1.15%) VJ-gene empirically assigned alignments: 0 (0%) UMI empirically assigned alignments: 0 (0%) Number of ambiguous UMIs: 14 Number of ambiguous V-genes: 5 Number of ambiguous J-genes: 3 Number of ambiguous UMI+V/J-gene combinations: 8 Unassigned alignments: 5618 (1.15%) Final clonotype count: 8448 Average number of reads per clonotype: 56.69 Reads used in clonotypes, percent of total: 478906 (82%) Reads used in clonotypes before clustering, percent of total: 479893 (82.17%) Number of reads used as a core, percent of used: 479850 (99.99%) Mapped low quality reads, percent of used: 43 (0.01%) Reads clustered in PCR error correction, percent of used: 987 (0.21%) Reads pre-clustered due to the similar VJC-lists, percent of used: 10879 (2.27%) Reads dropped due to the lack of a clone sequence, percent of total: 7977 (1.37%) Reads dropped due to a too short clonal sequence, percent of total: 0 (0%) Reads dropped due to low quality, percent of total: 3 (0%) Reads dropped due to failed mapping, percent of total: 10 (0%) Reads dropped with low quality clones, percent of total: 214 (0.04%) Clonotypes eliminated by PCR error correction: 60 Clonotypes dropped as low quality: 3 Clonotypes pre-clustered due to the similar VJC-lists: 299 IGH chains: 1533 (18.15%) IGH non-functional: 43 (2.8%) IGK chains: 3432 (40.62%) IGK non-functional: 209 (6.09%) IGL chains: 3483 (41.23%) IGL non-functional: 233 (6.69%)
js { "type": "alignerReport", "commandLine": "--report results/FebControl1.align.report.txt --json-report results/FebControl1.align.report.json --preset local:takara-smarter-human-bcr-cdr3 /raw/PRJEB44566_takara_hsa_bcr/FebControl1_R1.fastq.gz /raw/PRJEB44566_takara_hsa_bcr/FebControl1_R2.fastq.gz results/FebControl1.vdjca", "inputFiles": [ "/raw/PRJEB44566_takara_hsa_bcr/FebControl1_R1.fastq.gz", "/raw/PRJEB44566_takara_hsa_bcr/FebControl1_R2.fastq.gz" ], "outputFiles": [ "results/FebControl1.vdjca" ], "version": "; built=Mon Sep 26 10:55:18 CEST 2022; rev=8c998df1ab; lib=repseqio.v2.0", "trimmingReport": null, "totalReadsProcessed": 584053, "aligned": 525390, "notAligned": 58663, "notAlignedReasons": { "VAndJOnDifferentTargets": 361, "NoBarcode": 0, "LowTotalScore": 0, "NoCDR3Parts": 0, "NoHits": 49276, "NoJHits": 6044, "NoVHits": 2982 }, "chimeras": 0, "overlapped": 509629, "alignmentAidedOverlaps": 22223, "overlappedAligned": 466857, "overlappedNotAligned": 42772, "pairedEndAlignmentConflicts": 42139, "vChimeras": 1154, "jChimeras": 2, "chainUsage": { "type": "chainUsage", "chimeras": 0, "total": 525390, "chains": { "IGH": { "total": 116697, "nonFunctional": 3925, "isOOF": 1803, "hasStops": 2122 }, "IGK": { "total": 203474, "nonFunctional": 8958, "isOOF": 8193, "hasStops": 765 }, "IGL": { "total": 205219, "nonFunctional": 11257, "isOOF": 9534, "hasStops": 1723 } } }, "realignedWithForcedNonFloatingBound": 193294, "realignedWithForcedNonFloatingRightBoundInLeftRead": 52153, "realignedWithForcedNonFloatingLeftBoundInRightRead": 52153, "noCDR3PartsAlignments": 89, "partialAlignments": 2659, "tagReport": { "type": "tagReport" } } { "type": "refineTagsAndSort", "commandLine": "--report results/FebControl1.refine.report.txt --json-report results/FebControl1.refine.report.json results/FebControl1.vdjca results/FebControl1.refined.vdjca", "inputFiles": [ "results/FebControl1.vdjca" ], "outputFiles": [ "results/FebControl1.refined.vdjca" ], "version": "; built=Mon Sep 26 10:55:18 CEST 2022; rev=8c998df1ab; lib=repseqio.v2.0", "correctionReport": { "inputRecords": 525390, "outputRecords": 487187, "steps": [ { "tagName": "UMI", "inputGroups": 1, "inputDiversity": 60939, "inputCount": 525390, "coreDiversity": 48831, "coreCount": 513049, "directlyCorrectedDiversity": 15939, "directlyCorrectedCount": 16711, "filteredDiversity": 3134, "filteredCount": 3151, "recursivelyCorrected": 878, "diversityFilteredByWhitelist": 0, "outputDiversity": 41866, "outputCount": 522239 } ], "filterReport": { "type": "filter_groups_report", "groupingKeys": [ "UMI" ], "numberOfGroups": 41866, "numberOfGroupsAccepted": 15113, "totalWeight": 522239, "totalWeightAccepted": 487187, "operatorReports": [ { "type": "generic_hist_report", "threshold": 6 } ], "metricHists": [ { "metric": { "type": "group_metric_sum_weight", "reportHist": { "log": true, "binNumber": 0, "minBinWidth": 0.2 } }, "hist": { "bins": [ { "from": 1, "to": 1.5848931924611136, "weight": 21923 }, { "from": 1.5848931924611136, "to": 2.51188643150958, "weight": 2805 }, { "from": 2.51188643150958, "to": 3.981071705534973, "weight": 988 }, { "from": 3.981071705534973, "to": 6.309573444801933, "weight": 1402 }, { "from": 6.309573444801933, "to": 10, "weight": 887 }, { "from": 10, "to": 15.848931924611142, "weight": 1763 }, { "from": 15.848931924611142, "to": 25.11886431509581, "weight": 3594 }, { "from": 25.11886431509581, "to": 39.810717055349734, "weight": 5109 }, { "from": 39.810717055349734, "to": 63.09573444801933, "weight": 2481 }, { "from": 63.09573444801933, "to": 100, "weight": 548 }, { "from": 100, "to": 158.48931924611142, "weight": 223 }, { "from": 158.48931924611142, "to": 251.18864315095823, "weight": 118 }, { "from": 251.18864315095823, "to": 398.1071705534973, "weight": 25 } ], "collectionSpec": { "log": true, "binNumber": 0, "minBinWidth": 0.2 } } } ] } } } { "type": "assemblerReport", "commandLine": "--report results/FebControl1.assemble.report.txt --json-report results/FebControl1.assemble.report.json results/FebControl1.refined.vdjca results/FebControl1.clns", "inputFiles": [ "results/FebControl1.refined.vdjca" ], "outputFiles": [ "results/FebControl1.clns" ], "version": "; built=Mon Sep 26 10:55:18 CEST 2022; rev=8c998df1ab; lib=repseqio.v2.0", "preCloneAssemblerReport": { "type": "preCloneAssemblerReport", "inputGroups": 15113, "inputAlignments": 487187, "clonotypes": 14993, "clonotypesPerGroup": { "0": 89, "1": 14965, "2": 14 }, "coreAlignments": 474527, "discardedCoreAlignments": 4683, "empiricallyAssignedAlignments": 5590, "vjEmpiricallyAssignedAlignments": 0, "umiEmpiricallyAssignedAlignments": 0, "gatEmpiricallyAssignedAlignments": 5590, "empiricalAssignmentConflicts": 0, "unassignedAlignments": 5618, "umiConflicts": 14, "gatConflicts": 8, "geneConflicts": { "Variable": 5, "Joining": 3 }, "coreClonotypesDroppedByTagSuffix": 0, "coreAlignmentsDroppedByTagSuffix": 0 }, "totalReadsProcessed": 584053, "initialClonesCreated": 8810, "readsDroppedNoTargetSequence": 7977, "readsDroppedTooShortClonalSequence": 0, "readsDroppedLowQuality": 0, "coreReads": 479850, "readsDroppedFailedMapping": 10, "lowQualityRescued": 43, "clonesClustered": 60, "readsClustered": 987, "clones": 8448, "clonesDroppedAsLowQuality": 3, "clonesPreClustered": 299, "readsPreClustered": 10879, "readsInClones": 478906, "readsInClonesBeforeClustering": 479893, "readsDroppedWithLowQualityClones": 214, "clonalChainUsage": { "type": "chainUsage", "chimeras": 0, "total": 8448, "chains": { "IGH": { "total": 1533, "nonFunctional": 43, "isOOF": 32, "hasStops": 11 }, "IGK": { "total": 3432, "nonFunctional": 209, "isOOF": 206, "hasStops": 3 }, "IGL": { "total": 3483, "nonFunctional": 233, "isOOF": 223, "hasStops": 10 } } } }