action.skip

SMARTer Human BCR IgG IgM H/K/L Profiling Sequencing Kit (Takara Bio Inc.)

Here we will discuss how to process BCR cDNA libraries obtained with SMARTer Human BCR IgG IgM H/K/L Profiling Sequencing Kit (Takara Bio Inc.).

Data libraries

This tutorial uses the data from the following publication: The autoimmune signature of hyperinflammatory multisystem inflammatory syndrome in children Rebecca A. Porritt, et al,JCI (2021) doi:10.1172/JCI151520

Library construction was performed using the SMARTer Human BCR IgG IgM H/K/L Profiling Sequencing Kit (Takara Bio Inc.). Up to 50 ng of total RNA per sample was used for reverse transcription, followed by 4 separate PCR amplification reactions for IgG, IgM, IgK, and IgL. A second round of PCR amplified the entire BCR variable region and a small portion of the constant region. After size selection, quantification and fragment analysis of the individual libraries were performed. Individual chains were then pooled and sequenced on the MiSeq (Illumina) using 2 × 300 bp sequencing. Fastq raw data have been deposited in the European Nucleotide Archive (ENA) under accession number PRJEB44566.

Note

FASTQ files have been merged, thus every pair of FASTQ files holds sequences for all chains corresponding to a sample.

On the scheme bellow you can see structure of cDNA library. UMI is located in the first 12 bp of R2.

All data may be downloaded directly from SRA (PRJEB44566) using e.g. SRA Explorer.

Use aria2c for efficient download of the full dataset with the proper filenames:

download.sh
mkdir -p raw
aria2c -c -s 16 -x 16 -k 1M -j 8 -i download-list.txt
download-list.txt
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/003/ERR5952573/ERR5952573_2.fastq.gz
  out=raw/FebControl1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/003/ERR5952573/ERR5952573_1.fastq.gz
  out=raw/FebControl1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/004/ERR5952574/ERR5952574_1.fastq.gz
  out=raw/FebControl2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/004/ERR5952574/ERR5952574_2.fastq.gz
  out=raw/FebControl2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/005/ERR5952575/ERR5952575_1.fastq.gz
  out=raw/FebControl3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/005/ERR5952575/ERR5952575_2.fastq.gz
  out=raw/FebControl3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/006/ERR5952576/ERR5952576_1.fastq.gz
  out=raw/FebControl4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/006/ERR5952576/ERR5952576_2.fastq.gz
  out=raw/FebControl4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/007/ERR5952577/ERR5952577_1.fastq.gz
  out=raw/FebControl5_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/007/ERR5952577/ERR5952577_2.fastq.gz
  out=raw/FebControl5_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/008/ERR5952578/ERR5952578_1.fastq.gz
  out=raw/FebControl6_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/008/ERR5952578/ERR5952578_2.fastq.gz
  out=raw/FebControl6_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/009/ERR5952579/ERR5952579_1.fastq.gz
  out=raw/FebControl7_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/009/ERR5952579/ERR5952579_2.fastq.gz
  out=raw/FebControl7_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/000/ERR5952580/ERR5952580_1.fastq.gz
  out=raw/FebControl8_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/000/ERR5952580/ERR5952580_2.fastq.gz
  out=raw/FebControl8_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/001/ERR5952581/ERR5952581_1.fastq.gz
  out=raw/FebControl9_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/001/ERR5952581/ERR5952581_2.fastq.gz
  out=raw/FebControl9_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/002/ERR5952582/ERR5952582_1.fastq.gz
  out=raw/FebControl10_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/002/ERR5952582/ERR5952582_2.fastq.gz
  out=raw/FebControl10_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/003/ERR5952583/ERR5952583_1.fastq.gz
  out=raw/FebControl11_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/003/ERR5952583/ERR5952583_2.fastq.gz
  out=raw/FebControl11_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/004/ERR5952584/ERR5952584_1.fastq.gz
  out=raw/FebControl12_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/004/ERR5952584/ERR5952584_2.fastq.gz
  out=raw/FebControl12_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/005/ERR5952585/ERR5952585_1.fastq.gz
  out=raw/FebControl13_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/005/ERR5952585/ERR5952585_2.fastq.gz
  out=raw/FebControl13_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/006/ERR5952586/ERR5952586_1.fastq.gz
  out=raw/FebControl14_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/006/ERR5952586/ERR5952586_2.fastq.gz
  out=raw/FebControl14_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/007/ERR5952587/ERR5952587_1.fastq.gz
  out=raw/FebControl15_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/007/ERR5952587/ERR5952587_2.fastq.gz
  out=raw/FebControl15_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/008/ERR5952588/ERR5952588_1.fastq.gz
  out=raw/MISC1_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/008/ERR5952588/ERR5952588_2.fastq.gz
  out=raw/MISC1_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/009/ERR5952589/ERR5952589_1.fastq.gz
  out=raw/MISC2_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/009/ERR5952589/ERR5952589_2.fastq.gz
  out=raw/MISC2_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/000/ERR5952590/ERR5952590_1.fastq.gz
  out=raw/MISC3_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/000/ERR5952590/ERR5952590_2.fastq.gz
  out=raw/MISC3_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/001/ERR5952591/ERR5952591_1.fastq.gz
  out=raw/MISC4_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/001/ERR5952591/ERR5952591_2.fastq.gz
  out=raw/MISC4_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/002/ERR5952592/ERR5952592_1.fastq.gz
  out=raw/MISC5_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/002/ERR5952592/ERR5952592_2.fastq.gz
  out=raw/MISC5_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/003/ERR5952593/ERR5952593_1.fastq.gz
  out=raw/MISC6_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/003/ERR5952593/ERR5952593_2.fastq.gz
  out=raw/MISC6_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/004/ERR5952594/ERR5952594_1.fastq.gz
  out=raw/MISC7_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/004/ERR5952594/ERR5952594_2.fastq.gz
  out=raw/MISC7_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/005/ERR5952595/ERR5952595_1.fastq.gz
  out=raw/MISC8_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/005/ERR5952595/ERR5952595_2.fastq.gz
  out=raw/MISC8_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/006/ERR5952596/ERR5952596_1.fastq.gz
  out=raw/MISC9_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/006/ERR5952596/ERR5952596_2.fastq.gz
  out=raw/MISC9_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/007/ERR5952597/ERR5952597_1.fastq.gz
  out=raw/MISC10_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/007/ERR5952597/ERR5952597_2.fastq.gz
  out=raw/MISC10_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/008/ERR5952598/ERR5952598_1.fastq.gz
  out=raw/MISC11_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/008/ERR5952598/ERR5952598_2.fastq.gz
  out=raw/MISC11_R2.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/009/ERR5952599/ERR5952599_1.fastq.gz
  out=raw/MISC12_R1.fastq.gz
ftp://ftp.sra.ebi.ac.uk/vol1/fastq/ERR595/009/ERR5952599/ERR5952599_2.fastq.gz
  out=raw/MISC12_R2.fastq.gz

Upstream analysis

MiXCR has a dedicated preset for this protocol, thus analysing the data is as easy as:

shell mixcr analyze takara-human-rna-bcr-umi-smartseq \ raw/FebControl1_R1.fastq.gz \ raw/FebControl1_R2.fastq.gz \ results/FebControl1

Running the command above will generate the following files:

```shell

ls result/

human-readable reports

FebControl1.report

raw alignments (highly compressed binary file)

FebControl1.vdjca

alignments with refined UMI barcode sequences

FebControl1.refined.vdjca

IGH, IGK and IGL CDR3 clonotypes (highly compressed binary file)

FebControl1.clns

IGH, IGK and IGL CDR3 clonotypes exported in tab-delimited txt

FebControl1.clonotypes.IGH.tsv FebControl1.clonotypes.IGK.tsv FebControl1.clonotypes.IGL.tsv ```

While .clns file holds all data and is used for downstream analysis using mixcr postanalisis, the output .txt clonotype table will contain exhaustive information about each clonotype as well:

See first 100 records from FebControl1.clones.IGH.tsv clonotype table
cloneId cloneCount uniqueTagCountUMI cloneFraction targetSequences targetQualities allVHitsWithScore allDHitsWithScore allJHitsWithScore allCHitsWithScore allVAlignments allDAlignments allJAlignments allCAlignments nSeqFR1 minQualFR1 nSeqCDR1 minQualCDR1 nSeqFR2 minQualFR2 nSeqCDR2 minQualCDR2 nSeqFR3 minQualFR3 nSeqCDR3 minQualCDR3 nSeqFR4 minQualFR4 aaSeqFR1 aaSeqCDR1 aaSeqFR2 aaSeqCDR2 aaSeqFR3 aaSeqCDR3 aaSeqFR4 refPoints
0 2432 97 0.00507824 TGCATGCAAGGTCTACAAACTCCGTACACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV2D-28*00(2473) nan IGKJ2*00(377.6) IGKC*00(169) 276 300 319 0 24 SC286G 211.0 nan 21 31 59 23 33 100.0 nan nan nan nan nan nan nan nan nan nan nan
1 1019 35 0.00212777 TGTCAGCAATATTATAGTACTCCGTACACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV4-1*00(2886) nan IGKJ2*00(376.5) IGKC*00(169.2) 279 302 323 0 23 230.0 nan 21 31 59 23 33 100.0 nan nan nan nan nan nan nan nan nan nan nan
2 993 41 0.00207348 TGTCAGCAATATTATAGTACTCCGCTCACTTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV4-1*00(2943.3) nan IGKJ4*00(389.3) IGKC*00(169.4) 279 302 323 0 23 230.0 nan 19 30 58 22 33 110.0 nan nan nan nan nan nan nan nan nan nan nan
3 937 37 0.00195654 TGTCAGCAGTATAATAACTGGCCTCCGTGGACGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV3-15*00(2818.7) nan IGKJ1*00(388.4) IGKC*00(169.4) 261 285 305 0 24 240.0 nan 19 30 58 25 36 110.0 nan nan nan nan nan nan nan nan nan nan nan
4 933 33 0.00194819 TGTCAGGAGTATAATAGTTGGCCTCCGTGGACGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV3-15*00(2243.3) nan IGKJ1*00(331.1) IGKC*00(169.4) 261 285 305 0 24 SC267GSA277GSC278T 153.0 nan 19 30 58 25 36 110.0 nan nan nan nan nan nan nan nan nan nan nan
5 881 30 0.00183961 TGTCAACAGAGTTACAGTACCCCGTACACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV1D-39*00(2785.3) nan IGKJ2*00(375.3) IGKC*00(169.2) 261 284 305 0 23 230.0 nan 21 31 59 23 33 100.0 nan nan nan nan nan nan nan nan nan nan nan
6 834 24 0.00174147 TGTCAATCTTCAGACAGCAGTAGCACTTATGTCATATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV3-25*00(2297.8) nan IGLJ2*00(302.5) IGLC300(137.4),IGLC700(137.4) 258 288 310 0 30 SA266TSG267TSG279AST281C 184.0 nan 19 30 58 28 39 SG23CSG24ASC29T 23.0 ; nan nan nan nan nan nan nan nan nan nan
7 807 28 0.00168509 TGTCAGCAGCGTAGCAACTGGCCTCTCACTTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV3-11*00(2638) nan IGKJ4*00(366.7) IGKC*00(169.4) 261 285 305 0 24 240.0 nan 21 30 58 24 33 90.0 nan nan nan nan nan nan nan nan nan nan nan
8 801 28 0.00167256 TGTGCAGCATGGGATGACAGCCTGAATGGTTGGGTGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV1-44*00(2784.9) nan IGLJ3*00(374.6) IGLC300(143.7),IGLC700(143.7) 264 294 316 0 30 300.0 nan 20 30 58 29 39 100.0 ; nan nan nan nan nan nan nan nan nan nan
9 786 6 0.00164124 TGTGCGAGAGTGCTGCGGGTAGCTGGAAGAGTACCAGTTGCTATGGACTTTGACTACCGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-18*00(2370.4) IGHD2-2*00(66) IGHJ4*00(417.3) IGHG100(121.9),IGHG200(121.9),IGHG400(121.9),IGHGP00(121.9) 285 295 316 0 10 100.0 44 60 93 29 45 SC52T 66.0 23 37 68 46 60 ST34C 111.0 ;;; nan nan nan nan
10 770 20 0.00160783 TGTCAATCAACAGACATCTCTAGTACTTATGTGATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV3-25*00(2197.1) nan IGLJ2*00(331.2) IGLC300(140.4),IGLC700(140.4) 258 288 310 0 30 SG267ASG274TSA276TSG277CSG279A 155.0 nan 19 30 58 28 39 SG24ASA26C 52.0 ; nan nan nan nan nan nan nan nan nan nan
11 737 4 0.00153892 TGTGCGAGGGGGAGAGAATACCATGGATCGGGGAGTCTCATCTACTTTGACCACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-61*00(1779.1) IGHD3-10*00(48) IGHJ4*00(379.6) IGHG100(121.9),IGHG200(121.9),IGHG400(121.9),IGHGP00(121.9) 288 296 319 0 8 80.0 35 53 93 18 36 ST38CST43ASA46G 48.0 21 37 68 41 57 ST31C 131.0 ;;; nan nan nan nan
12 712 25 0.00148672 TGTCAGCAATATTATAGTACTCCTCTCACTTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV4-1*00(2948.4) nan IGKJ4*00(367.7) IGKC*00(169.1) 279 303 323 0 24 240.0 nan 21 30 58 24 33 90.0 nan nan nan nan nan nan nan nan nan nan nan
13 690 25 0.00144078 TGTCAGCAGCGTAGCAACTGGCCGCTCACTTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV3-11*00(2769.5) nan IGKJ4*00(382.7) IGKC*00(169.3) 261 284 305 0 23 230.0 nan 19 30 58 22 33 110.0 nan nan nan nan nan nan nan nan nan nan nan
14 686 7 0.00143243 TGTGCAAAAGATCTTTCTGGGGCCTACGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(2232) IGHD7-27*00(30) IGHJ4*00(399.4) IGHG100(122.4),IGHG200(122.4),IGHG400(122.4),IGHGP00(122.4) 285 299 316 0 14 SG292A 111.0 15 21 33 16 22 30.0 28 37 68 27 36 90.0 ;;; nan nan nan nan
15 664 20 0.00138649 TGTGCAGCATGGGATGACAGCCTGAATGGTTGGGTGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV1-44*00(2816.3) nan IGLJ3*00(377.9) IGLC2*00(133.1) 264 294 316 0 30 300.0 nan 20 30 58 29 39 100.0 nan nan nan nan nan nan nan nan nan nan nan
16 647 26 0.001351 TGTCAGCAGTATAATAACTGGCCTCCGTACACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV3-15*00(2734.3) nan IGKJ2*00(376.2) IGKC*00(169.1) 261 285 305 0 24 240.0 nan 21 31 59 26 36 100.0 nan nan nan nan nan nan nan nan nan nan nan
17 636 20 0.00132803 TGTCAGCAGCGTAGCAACTGGCCTCCGTGGACGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV3-11*00(2764.7) nan IGKJ1*00(389.4) IGKC*00(169.1) 261 285 305 0 24 240.0 nan 19 30 58 25 36 110.0 nan nan nan nan nan nan nan nan nan nan nan
18 620 7 0.00129462 TGTGCGAGAGATCTGGACTATATGGTTCGGGGAGTTATTATAACGTACAACTATAACTACGGTATGGAGGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-18*00(2558.3) IGHD3-10*00(111) IGHJ6*00(492.4) IGHG3*00(122.6) 285 299 316 0 14 140.0 38 63 93 20 45 SA46G 111.0 22 52 83 45 75 ST25ASC30TST31ASC45G 184.0 nan nan nan nan nan
19 602 7 0.00125703 TGTGCGAAAGATCTGTGGGGGGAGACTACAAGGAACACCGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-30*00(1777.3) IGHD2-1500(35),IGHD2-200(35),IGHD4-11*00(35) IGHJ6*00(467.4) IGHG100(121.6),IGHG200(121.6),IGHG400(121.6),IGHGP00(121.6) 285 299 316 0 14 140.0 18 25 93 24 31 35.0;18 25 93 24 31 35.0;17 24 48 23 30 35.0
20 593 24 0.00123824 TGTCAGCAGTATAATAACTGGCCTCGGACGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV3-15*00(2786.3) nan IGKJ1*00(356.4) IGKC*00(169.2) 261 288 305 0 27 SA285C 241.0 nan 22 30 58 25 33 80.0 nan nan nan nan nan nan nan nan nan nan nan
21 593 18 0.00123824 TGTCAGCAGCGTAGCAACTGGCCTCCGCTCACTTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV3-11*00(2777.3) nan IGKJ4*00(387) IGKC*00(169.3) 261 285 305 0 24 240.0 nan 19 30 58 25 36 110.0 nan nan nan nan nan nan nan nan nan nan nan
22 590 18 0.00123197 TGTCAATCAACAGACAGCAGTAGTACTTATGTACTCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV3-25*00(2371) nan IGLJ200(309.6),IGLJ300(309.6) IGLC300(140.6),IGLC700(140.6) 258 288 310 0 30 SG267ASG279A 242.0 nan 27 30 58 36 39 30.0;27 30 58 36 39 30.0 ; nan nan nan nan
23 581 16 0.00121318 TGCTCAGCGTGGGATAGCAGACTCAATGCTTGGTTGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV10-54*00(2425.4) nan IGLJ3*00(293.3) IGLC300(147.4),IGLC700(147.4) 264 294 316 0 30 SA272GSC278TSC284ASG289A 184.0 nan 20 30 58 29 39 SG24T 71.0 ; nan nan nan nan nan nan nan nan nan nan
24 578 3 0.00120692 TGTGCGAAATTCCCGTATAGTAGCCCTGCCGGGTCCCACTTTGACTGCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(2313.1) IGHD6-2500(38),IGHD1-2600(36),IGHD6-13*00(36) IGHJ4*00(418.7) IGHG3*00(122.7) 285 294 316 0 9 90.0 0 11 54 19 29 DG6 38.0;18 28 60 11 21 SG20C 36.0;23 33 63 14 24 SC29T 36.0
25 559 5 0.00116724 TGTGCGAAAGCTGGCTACGGTGACAATACAGGGGCAATTGACCGCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(1960) IGHD4-17*00(51) IGHJ5*00(312.4) IGHG100(122.2),IGHG200(122.2),IGHG400(122.2),IGHGP00(122.2) 285 295 316 0 10 100.0 16 29 48 11 24 SA18G 51.0 31 40 71 39 48 SC35G 61.0 ;;; nan nan nan nan
26 559 17 0.00116724 TGCAGCTCATATACAAGCAGCAGCACTCTCGTGGTATTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV2-14*00(2834.5) nan IGLJ2*00(362.7) IGLC300(143.7),IGLC700(143.7) 267 298 317 0 31 310.0 nan 21 30 58 30 39 90.0 ; nan nan nan nan nan nan nan nan nan nan
27 553 19 0.00115472 TGCCAGTCCTATGACAGCAGCCTGAGTGGTGTGGTATTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV1-40*00(2843.7) nan IGLJ2*00(373) IGLC300(144.5),IGLC700(144.5) 267 297 319 0 30 300.0 nan 20 30 58 29 39 100.0 ; nan nan nan nan nan nan nan nan nan nan
28 549 4 0.00114636 TGTGCGAGAACCCTCGATATTGCAGCACTTCCAGCTGCTGTTCGGCGGGATGGCTACTTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-34*00(2379.4) IGHD2-2*00(64) IGHJ4*00(437.7) IGHG100(121.1),IGHG200(121.1),IGHG400(121.1),IGHGP00(121.1) 282 297 313 0 15 SG291ASG292C 92.0 33 57 93 15 39 ST40CST43CSG45CSA47T 64.0 21 37 68 53 69 SA32C 131.0 ;;; nan nan nan nan
29 547 9 0.00114219 TGTGTGAGAGACGGGCCCCCTTACAATTTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-33*00(1653.8) IGHD3-16*00(25) IGHJ4*00(314.3) IGHG100(112.7),IGHG200(112.7),IGHG4*00(112.7) 285 296 316 0 11 SC289T 81.0 15 20 111 15 20 25.0 19 37 68 21 39 ST22ASC24T 122.0 ;; nan nan nan nan
30 543 17 0.00113383 TGCTGCTCATATGCAGGTAGTAGCACTTGGGTGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV2-23*00(2834.9) nan IGLJ3*00(376.8) IGLC300(139.6),IGLC700(139.6) 267 295 317 0 28 280.0 nan 17 30 58 23 36 SA19C 101.0 ; nan nan nan nan nan nan nan nan nan nan
31 539 17 0.00112548 TGTGCAGCATGGGATGACAGCCTGAGTGGTTGGGTGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV1-47*00(2859.2) nan IGLJ3*00(379.1) IGLC300(144.3),IGLC700(144.3) 264 294 316 0 30 300.0 nan 20 30 58 29 39 100.0 ; nan nan nan nan nan nan nan nan nan nan
32 535 18 0.00111713 TGCAGCTCATATACAAGCAGCAGCACTTGGGTGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV2-14*00(2830.5) nan IGLJ3*00(373.8) IGLC2*00(140.2) 267 294 317 0 27 270.0 nan 17 30 58 23 36 SA19C 101.0 nan nan nan nan nan nan nan nan nan nan nan
33 534 22 0.00111504 TGCATGCAAGCTCTACAAACTCCGTACACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV2D-28*00(2763.3) nan IGKJ2*00(377.3) IGKC*00(169.2) 276 300 319 0 24 240.0 nan 21 31 59 23 33 100.0 nan nan nan nan nan nan nan nan nan nan nan
34 529 3 0.0011046 TGTGCGAGACGGGCTTTACTTCTCTGGTCGTTCGACCTTTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-31*00(1992.7) IGHD6-600(26),IGHD3-1000(25),IGHD6-13*00(25) IGHJ5*00(381.1) IGHG100(122.2),IGHG200(122.2),IGHG400(122.2),IGHGP00(122.2) 288 297 319 0 9 90.0 9 17 54 12 20 SA12T 26.0;34 39 93 15 20 25.0;35 40 63 23 28 25.0
35 527 22 0.00110042 TGTCAACAGAGTTACAGTACCCCTCTCACTTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV1D-39*00(2856.1) nan IGKJ4*00(366.1) IGKC*00(169.4) 261 285 305 0 24 240.0 nan 21 30 58 24 33 90.0 nan nan nan nan nan nan nan nan nan nan nan
36 520 6 0.00108581 TGTGCGAGAGACCAACTTAAAGGAAAGAAGTGGGAATTACTTCTGTCCGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-61*00(1583.6) IGHD3-2200(39),IGHD1-2600(37) IGHJ6*00(410.7) IGHG100(121.4),IGHG200(121.4),IGHG400(121.4),IGHGP00(121.4) 288 299 319 0 11 110.0 41 60 93 22 41 ST43AST46AST52GST53A 39.0;25 38 60 28 41 SG32ASC33T 37.0 36 52 83 47 63
37 518 16 0.00108163 TGTCAATCTTCAGACAGCAGTAGCACTTATGTCATATTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV3-25*00(2225.6) nan IGLJ2*00(302.4) IGLC2*00(131.5) 258 288 310 0 30 SA266TSG267TSG279AST281C 184.0 nan 19 30 58 28 39 SG23CSG24ASC29T 23.0 nan nan nan nan nan nan nan nan nan nan nan
38 510 17 0.00106493 TGCCAGTCCTATGACAGCAGCCTGAGTGGTTGGGTGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV1-40*00(2837.2) nan IGLJ3*00(374.8) IGLC300(143.7),IGLC700(143.7) 267 298 319 0 31 310.0 nan 20 30 58 29 39 100.0 ; nan nan nan nan nan nan nan nan nan nan
39 508 14 0.00106075 TGTCAGGCGTGGGACAGCAGCACTGTGGTATTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV3-1*00(2566.3) nan IGLJ2*00(378.1) IGLC300(147.3),IGLC700(147.3) 258 283 305 0 25 250.0 nan 20 30 58 23 33 100.0 ; nan nan nan nan nan nan nan nan nan nan
40 506 4 0.00105657 TGTGCACGTCCGGGGCTTGGGGTGCGAGCTACTCTCTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-5*00(2824.2) IGHD1-26*00(46) IGHJ4*00(379.1) IGHG100(121.5),IGHG200(121.5),IGHG400(121.5),IGHGP00(121.5) 288 295 321 0 7 70.0 26 38 60 21 33 SG29C 46.0 30 37 68 35 42 70.0 ;;; nan nan nan nan
41 502 20 0.00104822 TGCATGCAAGCTCTACAAACTCCGTGGACGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV2D-28*00(2966.6) nan IGKJ1*00(389.5) IGKC*00(169.3) 276 300 319 0 24 240.0 nan 19 30 58 22 33 110.0 nan nan nan nan nan nan nan nan nan nan nan
42 499 5 0.00104196 TGTGCGAGAGATGATCGTAGGAGTTATTATGAGTATTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-7*00(2232) IGHD3-1000(50),IGHD3-2200(43) IGHJ4*00(350.1) IGHG100(120),IGHG200(120),IGHG400(120),IGHGP00(120) 285 297 316 0 12 120.0 48 58 93 19 29 50.0;41 58 93 12 29 SA44CST49GSG50A 43.0 27 37 68 29 39 SC30GSC33T
43 496 22 0.00103569 TGCCAGTCCTATGACAGCAGCCTGAGTGGTTATGTCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV1-40*00(2856.5) nan IGLJ1*00(379.1) IGLC1*00(221.6) 267 298 319 0 31 310.0 nan 20 30 58 29 39 100.0 nan nan nan nan nan nan nan nan nan nan nan
44 493 23 0.00102943 TGTAACTCCCGGGCCAGTAGTGGGACCTCTTATGTCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV3-19*00(2014.2) nan IGLJ1*00(321.4) IGLC1*00(220.6) 258 281 310 0 23 SA271CSC275T 172.0 nan 20 30 58 29 39 100.0 nan nan nan nan nan nan nan nan nan nan nan
45 490 15 0.00102317 TGTCAATCAGCAGACAGCAGTGGTACTTATGTGGTATTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV3-25*00(2767.4) nan IGLJ2*00(388.9) IGLC300(151.4),IGLC700(151.4) 258 288 310 0 30 300.0 nan 19 30 58 28 39 110.0 ; nan nan nan nan nan nan nan nan nan nan
46 490 15 0.00102317 TGTCAACAGAGTTACAGTACCCCTCGGACGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV1D-39*00(2866.1) nan IGKJ1*00(359) IGKC*00(169.5) 261 288 305 0 27 SA285C 241.0 nan 22 30 58 25 33 80.0 nan nan nan nan nan nan nan nan nan nan nan
47 488 15 0.00101899 TGCAGCTCATATACAAGCAGCAGCACTGTGGTATTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV2-14*00(2836.4) nan IGLJ2*00(378.5) IGLC300(140.8),IGLC700(140.8) 267 294 317 0 27 270.0 nan 20 30 58 26 36 100.0 ; nan nan nan nan nan nan nan nan nan nan
48 487 3 0.0010169 TGTGCAAGAGATTGGAGTCGGGCTGGTCCCTCAACTATTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(2538) IGHD6-1900(35),IGHD3-1000(31),IGHD6-13*00(30) IGHJ4*00(418) IGHG100(121.4),IGHG200(121.4),IGHG400(121.4),IGHGP00(121.4) 285 297 316 0 12 120.0 33 40 63 20 27 35.0;11 20 93 26 35 SG16C 31.0;34 40 63 21 27 30.0
49 479 15 0.0010002 TGCCAACAGTATAATAGTTATTGGACGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV1-5*00(2740.7) nan IGKJ1*00(368.9) IGKC*00(169.4) 261 283 305 0 22 220.0 nan 21 30 58 21 30 90.0 nan nan nan nan nan nan nan nan nan nan nan
50 471 13 0.000983492 TGTGCAGCATGGGATGACAGCCTGAATGGTGTGGTATTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV1-44*00(2725.2) nan IGLJ2*00(379.2) IGLC300(144.1),IGLC700(144.1) 264 294 316 0 30 300.0 nan 20 30 58 29 39 100.0 ; nan nan nan nan nan nan nan nan nan nan
51 470 16 0.000981403 TGTCAATCAACAGACAGCAGTAGTACTTATGTACTCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV3-25*00(2368.3) nan IGLJ200(309.1),IGLJ300(309) IGLC2*00(141.2) 258 288 310 0 30 SG267ASG279A 242.0 nan 27 30 58 36 39 30.0;27 30 58 36 39 30.0 nan nan nan nan nan
52 470 5 0.000981403 TGTGCGACAAATGACTTCGGTGACATAGCGGCGGGAAGGGGTTTGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-69D*00(1801.6) IGHD4-17*00(56) IGHJ6*00(429) IGHG100(121.7),IGHG200(121.7),IGHG400(121.7),IGHGP00(121.7) 285 292 316 0 7 70.0 15 29 48 10 24 SA21T 56.0 37 52 83 39 54 SA40T 121.0 ;;; nan nan nan nan
53 467 17 0.000975139 TGTCAACAGAGTTACAGTACCCCTCGAACGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV1D-39*00(2838.7) nan IGKJ1*00(336.9) IGKC*00(169.3) 261 285 305 0 24 240.0 nan 24 30 58 27 33 60.0 nan nan nan nan nan nan nan nan nan nan nan
54 465 3 0.000970963 TGTGCGAGAACTGCGGGATCTTGTCGCGCTACGTCTTGTCCACCGAACAACTGGTTCGGCCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(1865.9) IGHD7-2700(38),IGHD6-2500(35) IGHJ5*00(363.8) IGHG100(121.3),IGHG200(121.3),IGHG400(121.3),IGHGP00(121.3) 288 297 319 0 9 90.0 14 24 33 9 20 I18C 38.0;31 38 54 27 34 35.0 20 40 71 46 66 SA32G
55 457 3 0.000954258 TGTGCGAGAAATGACTTCGGTGACATTGCGGCGGGACGGGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-69D*00(1768.7) IGHD4-17*00(46) IGHJ6*00(429.2) IGHG100(122.2),IGHG200(122.2),IGHG400(122.2),IGHGP00(122.2) 285 297 316 0 12 SG294A 91.0 17 29 48 12 24 SA21T 46.0 37 52 83 39 54 150.0 ;;; nan nan nan nan
56 455 17 0.000950082 TGTCAGCAGTATAATAACTGGCCTCCGCTCACTTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV3-15*00(2768.3) nan IGKJ4*00(387.6) IGKC*00(169.3) 261 285 305 0 24 240.0 nan 19 30 58 25 36 110.0 nan nan nan nan nan nan nan nan nan nan nan
57 454 7 0.000947994 TGTGCGATCGGGGCCCGGCCCCACTTCTACTACTACACGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-59*00(1991.3) IGHD2-200(25),IGHD6-1300(25),IGHD6-25*00(25) IGHJ6*00(375.6) IGHG100(121.6),IGHG200(121.6),IGHG400(121.6),IGHGP00(121.6) 282 289 313 0 7 70.0 60 65 93 14 19 25.0;18 23 63 13 18 25.0;15 20 54 13 18 25.0
58 447 3 0.000933377 TGTGCCTCCTATAGCAGTAGTTGGCATGAGGCTTTTGATATGTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-8*00(1984.5) IGHD6-1300(47),IGHD6-1900(47),IGHD6-25*00(40) IGHJ3*00(429.2) IGHG100(121.2),IGHG200(121.2),IGHG400(121.2),IGHGP00(121.2) 285 290 316 0 5 50.0 24 39 63 9 24 SC32TSC35T 47.0;24 39 63 9 24 SG33ASC35T 47.0;21 29 54 9 17 40.0
59 443 5 0.000925025 TGTGCGACCAATTACGCTATTTGGAGTGGTTATGAAGTGGCCGATGCTTTTGAGATCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(2019.1) IGHD3-3*00(87) IGHJ3*00(427.1) IGHG100(122.2),IGHG200(122.2),IGHG400(122.2),IGHGP00(122.2) 288 295 319 0 7 70.0 33 56 93 10 33 SA39CST41A 87.0 21 39 70 42 60 ST32G 151.0 ;;; nan nan nan nan
60 440 14 0.000918761 TGTCAATCAGCAGACAGCAGTGGTACTTATGTCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV3-25*00(2685.2) nan IGLJ1*00(369.2) IGLC1*00(220.6) 258 288 310 0 30 300.0 nan 17 30 58 23 36 SA19C 101.0 nan nan nan nan nan nan nan nan nan nan nan
61 425 11 0.000887439 TGCCAGTCCTATGACAGCAGCCTGAGTGCCTCGGTGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV1-40*00(2484.9) nan IGLJ3*00(343.7) IGLC300(142.2),IGLC700(142.2) 267 295 319 0 28 280.0 nan 23 30 58 32 39 70.0 ; nan nan nan nan nan nan nan nan nan nan
62 424 2 0.000885351 TGTGCGAGGGGGTCGGGGAAAAACTACTTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(2219.4) IGHD3-1600(25),IGHD7-2700(25) IGHJ4*00(419.1) IGHG100(122.5),IGHG200(122.5),IGHG400(122.5),IGHGP00(122.5) 288 296 319 0 8 80.0 55 60 111 14 19 25.0;17 22 33 14 19 25.0 20 37 68 22 39 SA32C
63 423 5 0.000883263 TGTGCGAGAGAAGTCGGTCCTAAGGTTCGGGGAGTTATTATAACGCCAAACTGGTACGACGCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV7-4-1*00(2355.2) IGHD3-10*00(102) IGHJ5*00(429.4) IGHG100(119.8),IGHG200(119.8),IGHG400(119.8),IGHGP00(119.8) 285 296 316 0 11 110.0 37 63 93 19 45 ST40ASA46G 102.0 22 40 71 48 66 ST29ASC34G 122.0 ;;; nan nan nan nan
64 422 5 0.000881175 TGTGCGAGATGGGCGGGGGCATTCCAATGGTTAAAACCTCTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV7-4-1*00(2350.8) IGHD5-500(35),IGHD3-1000(32),IGHD3-3*00(30) IGHJ4*00(331.6) IGHG100(123.5),IGHG200(123.5),IGHG400(123.5),IGHGP00(123.5) 285 294 316 0 9 90.0 32 39 60 26 33 35.0;33 45 93 20 32 SA36CST38A 32.0;49 55 93 27 33 30.0
65 418 2 0.000872823 TGTGCCTCTTATGGTTCGGCGAGTTATTACTGGTTCGACCCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-5*00(2331.4) IGHD3-10*00(67) IGHJ5*00(479.6) IGHG100(121.2),IGHG200(121.2),IGHG400(121.2),IGHGP00(121.2) 288 293 321 0 5 50.0 38 57 93 9 28 SA46GSG48C 67.0 23 40 71 28 45 170.0 ;;; nan nan nan nan
66 416 12 0.000868646 TGTCAATCTTCAGACAGCAGTAGCACTTATGTCATATTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV3-25*00(2301.8) nan IGLJ2*00(330.6) IGLC300(133.5),IGLC700(133.5) 258 288 310 0 30 SA266TSG267TSG279AST281C 184.0 nan 19 30 58 28 39 SG23CSG24A 52.0 ; nan nan nan nan nan nan nan nan nan nan
67 414 15 0.00086447 TGTCAACAGGCTAACAGTTTCCCTCTCACTTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV1D-12*00(2676) nan IGKJ4*00(355.1) IGKC*00(169.2) 261 285 305 0 24 240.0 nan 21 30 58 24 33 90.0 nan nan nan nan nan nan nan nan nan nan nan
68 410 14 0.000856118 TGCAGCTCATATACAAGCAGCAGCACTTGGGTGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV2-14*00(2828.1) nan IGLJ3*00(374.2) IGLC300(141.1),IGLC700(141.1) 267 294 317 0 27 270.0 nan 17 30 58 23 36 SA19C 101.0 ; nan nan nan nan nan nan nan nan nan nan
69 401 5 0.000837325 TGTGTGAAAGATTATCCACGACCTTTGAGGGGGTTCCCCGGCGCGCCGGTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-23*00(1117.4) IGHD5-1200(40),IGHD5-500(40),IGHD7-27*00(36) IGHJ4*00(419.1) IGHG100(122.7),IGHG200(122.2),IGHG4*00(122.2) 285 297 316 0 12 SC289T 91.0 16 24 69 12 20 40.0;13 21 60 12 20 40.0;17 27 33 29 39 SA21T 36.0
70 400 15 0.000835237 TGTCAACAGTATAGAAGTGTCCCGTACACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV1-3300(2020),IGKV1D-3300(2020) nan IGKJ2*00(350.7) IGKC*00(169.3) 261 273 305 0 12 120.0;261 273 305 0 12 120.0 nan 21 31 59 23 33 100.0 nan nan nan nan nan
71 397 15 0.000828973 TGCATGCAAGGTCTACAAACTCCGTACACCTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV2D-28*00(2328) nan IGKJ2*00(324.6) IGKC*00(169.4) 276 300 319 0 24 SC286G 211.0 nan 21 31 59 23 33 ST27C 71.0 nan nan nan nan nan nan nan nan nan nan nan
72 389 8 0.000812268 TGCCAGTCCTTTGATCGCAGCCTGAGTGGTTGGGTGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV1-40*00(2466) nan IGLJ3*00(292.5) IGLC300(146.1),IGLC700(146.1) 267 298 319 0 31 SA277TSC281TSA282C 223.0 nan 20 30 58 29 39 100.0 ; nan nan nan nan nan nan nan nan nan nan
73 386 6 0.000806004 TGTGCAGCATGGGATGACAGCCTGAGTGGTGTGGTGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV1-47*00(2655.2) nan IGLJ3*00(233.6) IGLC2*00(132.6) 264 294 316 0 30 300.0 nan 23 30 58 32 39 70.0 nan nan nan nan nan nan nan nan nan nan nan
74 377 12 0.000787211 TGTCAGCAGTATGGTAGCTCACCGTACACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV3-20*00(2771.2) nan IGKJ2*00(371.9) IGKC*00(169.1) 264 287 308 0 23 230.0 nan 21 31 59 23 33 100.0 nan nan nan nan nan nan nan nan nan nan nan
75 364 12 0.000760066 TGCATGCAAGCTCTACAAACTCCGCTCACTTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV2D-28*00(2918.5) nan IGKJ4*00(388.6) IGKC*00(169.5) 276 300 319 0 24 240.0 nan 19 30 58 22 33 110.0 nan nan nan nan nan nan nan nan nan nan nan
76 363 11 0.000757978 TGTCAACAGAGTTACAGTACCCCGCTCACTTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV1D-39*00(2870.1) nan IGKJ4*00(388.4) IGKC*00(168.9) 261 284 305 0 23 230.0 nan 19 30 58 22 33 110.0 nan nan nan nan nan nan nan nan nan nan nan
77 360 11 0.000751713 TGTCAGCAGTATGGTAGCTCACCGTGGACGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV3-20*00(2826.6) nan IGKJ1*00(389) IGKC*00(169.2) 264 287 308 0 23 230.0 nan 19 30 58 22 33 110.0 nan nan nan nan nan nan nan nan nan nan nan
78 358 12 0.000747537 TGTCAGCAGTATAATAACTGGCCTCGAACGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV3-15*00(2753.2) nan IGKJ1*00(325.2) IGKC*00(169) 261 285 305 0 24 240.0 nan 24 30 58 27 33 60.0 nan nan nan nan nan nan nan nan nan nan nan
79 355 3 0.000741273 TGTATAAAAGACCAATATGGCCCAGAGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-74*00(1776) IGHD2-2100(35),IGHD2-1500(30),IGHD2-2*00(30) IGHJ4*00(330.1) IGHG100(120),IGHG200(120),IGHG400(120),IGHGP00(120) 285 288 316 0 3 30.0 19 26 84 12 19 35.0;22 28 93 12 18 30.0;22 28 93 12 18 30.0
80 355 15 0.000741273 TGCTGCTCATATGCAGGTAGTAGCACTTATGTCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV2-23*00(2812.9) nan IGLJ1*00(379) IGLC1*00(221.2) 267 295 317 0 28 280.0 nan 20 30 58 26 36 100.0 nan nan nan nan nan nan nan nan nan nan nan
81 354 12 0.000739185 TGTCAATCTTCAGACAGCACTAGTACTTATGTCATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV3-25*00(1973.5) nan IGLJ2*00(309) IGLC300(142.5),IGLC700(142.5) 258 288 310 0 30 SA266TSG267TSG277CSG279A 184.0 nan 27 30 58 36 39 30.0 ; nan nan nan nan nan nan nan nan nan nan
82 350 3 0.000730832 TGTGCGAGAGAGACACTGGGAGGTACGAAGTGGTTCGACCTTTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-2*00(2379.4) IGHD1-26*00(36) IGHJ5*00(401.1) IGHG100(122.5),IGHG200(122.5),IGHG400(122.5),IGHGP00(122.5) 285 296 316 0 11 110.0 27 37 60 16 26 SC33G 36.0 22 40 71 27 45 SC24GSC35TSC36T 93.0 ;;; nan nan nan nan
83 348 10 0.000726656 TGCATGCAAGGGACACACTGGCCTTACACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV2-3000(2680),IGKV2D-3000(2654.8) nan IGKJ2*00(360) IGKC*00(168.8) 276 300 320 0 24 ST287G 211.0;276 300 320 0 24 ST287G 211.0 nan 22 31 59 24 33 90.0 nan nan nan nan nan
84 347 8 0.000724568 TGTCAACAGTATAGAAGTGTCCCGTACACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV1D-33*00(2042.8) nan IGKJ2*00(349.4) IGKC*00(169.4) 261 273 305 0 12 120.0 nan 21 31 59 23 33 100.0 nan nan nan nan nan nan nan nan nan nan nan
85 344 14 0.000718304 TGTCAGCAGCGTAGCAACTGGCCTCCGATCACCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV3-11*00(2798.8) nan IGKJ5*00(387.1) IGKC*00(169.3) 261 285 305 0 24 240.0 nan 19 30 58 25 36 110.0 nan nan nan nan nan nan nan nan nan nan nan
86 344 12 0.000718304 TGTCAGCAATATTATATTGCTCCTCCAACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV4-1*00(2672.5) nan IGKJ2*00(339.2) IGKC*00(169.2) 279 303 323 0 24 SG295TSA297G 182.0 nan 25 31 59 27 33 60.0 nan nan nan nan nan nan nan nan nan nan nan
87 344 10 0.000718304 TGTCAATCAACAGACATCTCTAGTACTTATGTGATCTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV3-25*00(2267.3) nan IGLJ2*00(331.4) IGLC2*00(141.5) 258 288 310 0 30 SG267ASG274TSA276TSG277CSG279A 155.0 nan 19 30 58 28 39 SG24ASA26C 52.0 nan nan nan nan nan nan nan nan nan nan nan
88 342 9 0.000714128 TGCCAACAGTATAATAGTTACCCGTGGACGTTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV1-5*00(2734.5) nan IGKJ1*00(389.6) IGKC*00(168.7) 261 281 305 0 20 200.0 nan 19 30 58 22 33 110.0 nan nan nan nan nan nan nan nan nan nan nan
89 342 13 0.000714128 TGCATGCAAGGTACACACTGGCCTCCGTACACTTTT NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGKV2D-30*00(2897.6) nan IGKJ2*00(379.2) IGKC*00(169.3) 276 300 320 0 24 240.0 nan 21 31 59 26 36 100.0 nan nan nan nan nan nan nan nan nan nan nan
90 338 2 0.000705775 TGTGCGAGAGAGATGTACGGCATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-53*00(1923.8) nan IGHJ6*00(458.1) IGHG3*00(123.2) 282 293 313 0 11 110.0 nan 34 52 83 15 33 ST39C 151.0 nan nan nan nan nan nan nan nan nan nan nan
91 335 2 0.000699511 TGTGCGAGAAATGACTTCGGTGACATTACGGCGGGCCGGGGTATGGACGTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-69D*00(2039.6) IGHD4-17*00(46) IGHJ6*00(458.4) IGHG100(122.1),IGHG200(122.1),IGHG400(122.1),IGHGP00(121.8) 285 297 316 0 12 SG294A 91.0 17 29 48 12 24 SA21T 46.0 37 52 83 39 54 150.0 ;;; nan nan nan nan
92 333 1 0.000695335 TGTGCGAGATCGATTTTGGAGTGGTATCCCCTGGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-34*00(2138.6) IGHD3-3*00(63) IGHJ4*00(370.5) IGHG3*00(121.8) 282 291 313 0 9 90.0 37 53 93 10 25 DT40 63.0 28 37 68 33 42 90.0 nan nan nan nan nan
93 330 4 0.000689071 TGTGCAAAAGGTCTAGGCGAACACTTCTTTGACTCATGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-43*00(2123.6) IGHD2-1500(25),IGHD2-200(25),IGHD2-8*00(25) IGHJ4*00(360.8) IGHG100(121.7),IGHG200(121.7),IGHG400(121.7),IGHGP00(121.7) 285 295 318 0 10 100.0 29 34 93 12 17 25.0;29 34 93 12 17 25.0;29 34 93 12 17 25.0
94 329 2 0.000686982 TGTGCGAGCCCTATGCAGGAGGGGCCCCCCTTCCCATTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-39*00(2245.3) IGHD2-2*00(31) IGHJ4*00(340.5) IGHG100(122),IGHG200(122),IGHG400(122),IGHGP00(122) 288 296 319 0 8 80.0 55 64 93 10 19 SC61A 31.0 25 37 68 36 48 SA32C 91.0 ;;; nan nan nan nan
95 327 2 0.000682806 TGTGCTAGACAATCTGGAGCTGCTTTTGACTGCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV3-72*00(2331.4) IGHD6-600(40),IGHD2-1500(38),IGHD6-13*00(35) IGHJ4*00(397.8) IGHG100(121.6),IGHG200(121.6),IGHG400(121.6),IGHGP00(121.6) 291 300 322 0 9 90.0 4 12 54 16 24 40.0;46 57 93 14 24 DT49 38.0;5 12 63 17 24 35.0
96 327 3 0.000682806 TGTGCGAGAGGTCGCGATTACTATTTCACTGATGGTTCTTACTCCAAGGACCACTTTGACTCCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV4-61*00(1860.3) IGHD3-2200(41),IGHD5-1800(41),IGHD3-10*00(40) IGHJ4*00(278.1) IGHG100(122.3),IGHG200(122.3),IGHG400(122.3),IGHGP00(122.3) 288 301 319 0 13 SA298G 101.0 49 60 93 32 43 SA54C 41.0;12 27 69 19 32 DA17DG23 41.0;33 41 93 16 24 40.0
97 325 8 0.00067863 TGTAACTCCCGGGACAGCAGTGGTAACCATGTGGTATTC NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGLV3-19*00(2759.3) nan IGLJ2*00(398.8) IGLC300(148.2),IGLC700(148.2) 258 288 310 0 30 300.0 nan 18 30 58 27 39 120.0 ; nan nan nan nan nan nan nan nan nan nan
98 324 4 0.000676542 TGTGCACGGAGTACCGAACCACATTATAATTCAAACTTTGACTTCTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV2-70*00(1892.4) IGHD1-1400(38),IGHD3-1000(36),IGHD3-9*00(36) IGHJ4*00(359.9) IGHG100(122),IGHG200(122),IGHG400(122),IGHGP00(122) 288 298 321 0 10 100.0 23 34 51 12 22 DG26 38.0;60 70 93 20 30 SG62A 36.0;60 70 93 20 30 SG62A 36.0
99 322 3 0.000672366 TGTGCGAGAGAATGGATGGGGGATCGCTATCTTGACTACTGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN IGHV1-69D*00(2437.3) IGHD3-1600(35),IGHD7-2700(35),IGHD2-21*00(32) IGHJ4*00(330.6) IGHG100(123.4),IGHG200(123.4),IGHG400(123.4),IGHGP00(123.4) 285 296 316 0 11 110.0 53 60 111 16 23 35.0;17 24 33 18 25 35.0;41 53 84 18 30 ST43GST47C 32.0

In order to run the analysis for all samples in the project on Linux we can use GNU Parallel in the following way:

```shell

!/usr/bin/env bash

mkdir -p results

ls /raw/R1 | parallel -j 2 --line-buffer \ "mixcr analyze takara-human-rna-bcr-umi-smartseq \ {} \ {=s:R1:R2:=} \ {=s:./:results/:;s:_R.::=}" ```

Under the hood pipeline:

Under the hood the command above actually executes the following pipeline:

align

Alignment of raw sequencing reads against reference database of V-, D-, J- and C- gene segments.

shell mixcr align \ --species hsa \ -p generic-amplicon-with-umi \ -OvParameters.geneFeatureToAlign="VTranscriptWithout5UTRWithP" \ -OvParameters.parameters.floatingLeftBound=false \ -OjParameters.parameters.floatingRightBound=false \ -OсParameters.parameters.floatingRightBound=true \ --tag-pattern "^N{7}(R1:*) \ ^(UMI:N{12})N{4}(R2:*)" \ --report results/FebControl1.report.txt \ --json-report results/FebControl1.report.json \ raw/FebControl1_R1.fastq.gz \ raw/FebControl1_R2.fastq.gz \ results/FebControl1.vdjca

Option --report is specified here explicitly.

--species hsa
determines the organism species (hsa for Homo Sapiens).
-p generic-amplicon-with-umi
a default preset of MiXCR parameters for amplicon data with UMIs.
-OvParameters.geneFeatureToAlign="VTranscriptWithout5UTRWithP"
Sets a V gene feature to align. Check gene features for more info.
-OvParameters.parameters.floatingLeftBound=false
Results in a global alignment algorithm for V gene left bound. We use it because we don't have any primers covering V gene coding sequence.
-OjParameters.parameters.floatingRightBound=false
Results in a global alignment algorithm for J gene right bound, because reverse primers are located in C-gene region.
-OcParameters.parameters.floatingRightBound=true
Results in a local alignment algorithm for C gene right bound, because reverse primers are located in C-gene region.
--tagPattern "^N{7}(R1:*) \ ^(UMI:N{12})N{4}(R2:*)"
tag pattern specifies the location of the UMI barcode and also trims N nucleotides on the 5' end of R1 according to the library structure.

refineTagsAndSort

Corrects sequencing and PCR errors inside barcode sequences. This step does extremely important job by correcting artificial diversity caused by errors in barcodes. In the considered example project it corrects only sequences of UMIs.

shell mixcr refineTagsAndSort \ --report results/FebControl1.report.txt \ --json-report results/FebControl1.report.json \ results/FebControl1.vdjca \ results/FebControl1.refined.vdjca

assemble

Assembles alignments into clonotypes and applies several layers of errors correction:

  • quality-dependent correction for sequencing errors
  • PCR-error correction by clustering
  • UMI-based error correction)

Check mixcr assemble for more information.

shell mixcr assemble \ -OassemblingFeatures="CDR3" -OseparateByJ=true \ -OseparateByV=true \ -OseparateByC=true \ --report results/FebControl1.report.txt \ --json-report results/FebControl1.report.json \ results/FebControl1.refined.vdjca \ results/FebControl1.clns

Options --report and --json-report are specified here explicitly so that the report files will be appended with assembly report.

-OassemblingFeatures=CDR3
By default takara-hsa-bcr-cdr3 preset assembles clones by CDR3 sequence.
-separateByJ: true
Separate clones with the same assembling feature, but different V-genes.
-separateByV: true
Separate clones with the same assembling feature, but different J-genes.
-separateByC: true
Separate clones with the same assembling feature, but different C-genes. In this case the protocol utilizes sequence-specific primers that allow to separate IgG and IgM isotypes.

export

Exports clonotypes from .clns file into human-readable tables.

shell mixcr exportClones \ -c TRA \ results/S_s.clns \ results/S_s.clonotypes.TRA.txt

-с IGH
defines a specific chain to be exported.
-uniqueTagCount UMI
adds a column with the number of UMIs for each clone.

Quality control

Now when we have all files processed lets perform Quality Control. That can be easily done using mixcr exportQc function.

shell mixcr exportQc align results/*.clns figs/alignQc.pdf

align QC

The plot above demonstrates a high quality alignment rate. Nevertheless, about 10% of reads did not align to the reference. MiXCR provides a convenient way to extract not aligned reads and investigate their origin.

By default, MiXCR removed non target reads during alignment. We will realign reads for one of the samples (e.g. MISC9) and extract not aligned reads (--not-aligned-R1, --not-aligned-R2) to separate FASTQ files for manual inspection. See mixcr align for more details.

Bellow is the complete command:

```shell mkdir -p debug

mixcr align \ --species hsa \ -p bundle-umi-kaligner2-v1-base \ -OvParameters.geneFeatureToAlign="VTranscriptWithout5UTRWithP" \ -OvParameters.parameters.floatingLeftBound=false \ -OjParameters.parameters.floatingRightBound=false \ -OcParameters.parameters.floatingRightBound=true \ --tag-pattern "^N{7}(R1:) ^(UMI:N{12})N{4}(R2:)" \ --not-aligned-R1 debug/MISC9_notAligned_R1.fastq \ --not-aligned-R2 debug/MISC9_notAligned_R2.fastq \ --report debug/MISC9.report.txt \ --json-report debug/MISC9.report.json \ raw/MISC9_R1.fastq.gz \ raw/MISC9_R2.fastq.gz \ debug/MISC9.vdjca ```

Resulting MISC9_notAligned_R1.fastq and MISC9_notAligned_R2.fastq files can be manually inspected. A brief BLAST search revealed most not aligned sequences come from DNA sequence (in between gene segments or from immunoglobulin like genes (e.g.IGLL5) )

Now Lets look at the chain distribution in every sample.

shell mixcr exportQc chainUsage results/*.clns figs/chainUsage.pdf

chain usage QC

We see that in most sample number of light chains significantly dominate over IGH. Since libraries for all chains were generated in a separate PCR reactions according to the protocol, we might suggest that this bias arise from unequal mixing of cDNA libraries prior sequencing.

Full-length clonotype assembly

SMARTer Human BCR IgG IgM H/K/L Profiling Sequencing Kit allows to recover a broader BCR receptor sequence then just CDR3 region. Since this protocol is based on 5'RACE method, the full V-gene sequence should present. Reverse sequence specific primers are located in C-gene region providing enough sequence for IgG\IgM isotype identification.

Taking into account what is mentioned above, the longest possible assembling feature for this protocol is VDJRegion.

MiXCR has a specific preset to obtain full-length BCR clones with SMARTer Human BCR IgG IgM H/K/L Profiling Sequencing Kit:

shell mixcr analyze takara-human-rna-bcr-umi-smartseq \ raw/FebControl1_R1.fastq.gz \ raw/FebControl1_R2.fastq.gz \ results/FebControl1

The mixcr assemble step in this preset differs from the one above in the following manner:

shell mixcr assemble \ -OassemblingFeatures="VDJRegion" \ -OseparateByC=true \ --report results/FebControl1.report.txt \ --json-report results/FebControl1.report.json \ results/FebControl1.refined.vdjca \ results/FebControl1.clns

-OassemblingFeatures="VDJRegion"
sets the assembling feature to the region which starts from FR1Begin and ends at the end of FR4.

Notice that we do not use -OseparateByV=true and -OseparateByJ=true in this case because assembling feature already covers full V and J sequences, thus in case if clones have identical CDR3 they will still be separated. We still use -OseparateByC=true option for isotype identification.

Reports

Finally, MiXCR provides a very convenient way to look at the reports generated at ech step. Every .vdjca, .clns and .clna file holds all the reports for every MiXCR function that has been applied to this sample. E.g. in our case .clns file contains reports for mixcr align and mixcr assemble. To output this report use mixcr exportReports as shown bellow. Note --json parameter will output a JSON-formatted report.

shell mixcr exportReports \ results/FebControl1.clns \ results/FebControl1.report.txt

shell mixcr exportReports \ --json \ results/FebControl1.clns \ results/FebControl1.report.json

Show report file

shell ============== Align Report ============== Input file(s): /raw/PRJEB44566_takara_hsa_bcr/FebControl1_R1.fastq.gz,/raw/PRJEB44566_takara_hsa_bcr/FebControl1_R2.fastq.gz Output file(s): results/FebControl1.vdjca Version: ; built=Mon Sep 26 10:55:18 CEST 2022; rev=8c998df1ab; lib=repseqio.v2.0 Command line arguments: --report results/FebControl1.align.report.txt --json-report results/FebControl1.align.report.json --preset local:takara-smarter-human-bcr-cdr3 /raw/PRJEB44566_takara_hsa_bcr/FebControl1_R1.fastq.gz /raw/PRJEB44566_takara_hsa_bcr/FebControl1_R2.fastq.gz results/FebControl1.vdjca Analysis time: 0ns Total sequencing reads: 584053 Successfully aligned reads: 525390 (89.96%) Paired-end alignment conflicts eliminated: 42139 (7.21%) Alignment failed, no hits (not TCR/IG?): 49276 (8.44%) Alignment failed because of absence of V hits: 2982 (0.51%) Alignment failed because of absence of J hits: 6044 (1.03%) No target with both V and J alignments: 361 (0.06%) Overlapped: 509629 (87.26%) Overlapped and aligned: 466857 (79.93%) Alignment-aided overlaps: 22223 (4.76%) Overlapped and not aligned: 42772 (7.32%) No CDR3 parts alignments, percent of successfully aligned: 89 (0.02%) Partial aligned reads, percent of successfully aligned: 2659 (0.51%) V gene chimeras: 1154 (0.2%) J gene chimeras: 2 (0%) IGH chains: 116697 (22.21%) IGH non-functional: 3925 (3.36%) IGK chains: 203474 (38.73%) IGK non-functional: 8958 (4.4%) IGL chains: 205219 (39.06%) IGL non-functional: 11257 (5.49%) Realigned with forced non-floating bound: 193294 (33.1%) Realigned with forced non-floating right bound in left read: 52153 (8.93%) Realigned with forced non-floating left bound in right read: 52153 (8.93%) ============== RefineTagsAndSort Report ============== Input file(s): results/FebControl1.vdjca Output file(s): results/FebControl1.refined.vdjca Version: ; built=Mon Sep 26 10:55:18 CEST 2022; rev=8c998df1ab; lib=repseqio.v2.0 Command line arguments: --report results/FebControl1.refine.report.txt --json-report results/FebControl1.refine.report.json results/FebControl1.vdjca results/FebControl1.refined.vdjca Analysis time: 0ns Time spent in correction: 0ns UMI input diversity: 60939 UMI output diversity: 41866 (68.7%) UMI input reads: 525390 UMI output count: 522239 (99.4%) UMI mean reads per tag: 8.62 UMI input core diversity: 48831 (80.13%) UMI input core reads: 513049 (97.65%) UMI directly corrected diversity: 15939 (26.16%) UMI directly corrected reads: 16711 (3.18%) UMI diversity filtered by tag quality: 3134 (5.14%) UMI reads filtered by tag quality: 3151 (0.6%) UMI diversity filtered by whitelist: 0 (0%) UMI recursively corrected: 878 Number of output records: 487187 (92.73%) Filter report: Number of groups: 41866 Number of groups accepted: 15113 (36.1%) Total records weight: 522239.0 Records weight accepted: 487187.0 (93.29%) Operator #0: Effective threshold: 6.0 ============== Assemble Report ============== Input file(s): results/FebControl1.refined.vdjca Output file(s): results/FebControl1.clns Version: ; built=Mon Sep 26 10:55:18 CEST 2022; rev=8c998df1ab; lib=repseqio.v2.0 Command line arguments: --report results/FebControl1.assemble.report.txt --json-report results/FebControl1.assemble.report.json results/FebControl1.refined.vdjca results/FebControl1.clns Analysis time: 0ns Number of input groups: 15113 Number of input alignments: 487187 Number of output pre-clonotypes: 14993 Number of clonotypes per group: 0: + 89 (0.59%) = 89 (0.59%) 1: + 14965 (99.32%) = 15054 (99.91%) 2: + 14 (0.09%) = 15068 (100%) Number of core alignments: 474527 (97.4%) Discarded core alignments: 4683 (0.99%) Empirically assigned alignments: 5590 (1.15%) Empirical assignment conflicts: 0 (0%) UMI+VJ-gene empirically assigned alignments: 5590 (1.15%) VJ-gene empirically assigned alignments: 0 (0%) UMI empirically assigned alignments: 0 (0%) Number of ambiguous UMIs: 14 Number of ambiguous V-genes: 5 Number of ambiguous J-genes: 3 Number of ambiguous UMI+V/J-gene combinations: 8 Unassigned alignments: 5618 (1.15%) Final clonotype count: 8448 Average number of reads per clonotype: 56.69 Reads used in clonotypes, percent of total: 478906 (82%) Reads used in clonotypes before clustering, percent of total: 479893 (82.17%) Number of reads used as a core, percent of used: 479850 (99.99%) Mapped low quality reads, percent of used: 43 (0.01%) Reads clustered in PCR error correction, percent of used: 987 (0.21%) Reads pre-clustered due to the similar VJC-lists, percent of used: 10879 (2.27%) Reads dropped due to the lack of a clone sequence, percent of total: 7977 (1.37%) Reads dropped due to a too short clonal sequence, percent of total: 0 (0%) Reads dropped due to low quality, percent of total: 3 (0%) Reads dropped due to failed mapping, percent of total: 10 (0%) Reads dropped with low quality clones, percent of total: 214 (0.04%) Clonotypes eliminated by PCR error correction: 60 Clonotypes dropped as low quality: 3 Clonotypes pre-clustered due to the similar VJC-lists: 299 IGH chains: 1533 (18.15%) IGH non-functional: 43 (2.8%) IGK chains: 3432 (40.62%) IGK non-functional: 209 (6.09%) IGL chains: 3483 (41.23%) IGL non-functional: 233 (6.69%)

js { "type": "alignerReport", "commandLine": "--report results/FebControl1.align.report.txt --json-report results/FebControl1.align.report.json --preset local:takara-smarter-human-bcr-cdr3 /raw/PRJEB44566_takara_hsa_bcr/FebControl1_R1.fastq.gz /raw/PRJEB44566_takara_hsa_bcr/FebControl1_R2.fastq.gz results/FebControl1.vdjca", "inputFiles": [ "/raw/PRJEB44566_takara_hsa_bcr/FebControl1_R1.fastq.gz", "/raw/PRJEB44566_takara_hsa_bcr/FebControl1_R2.fastq.gz" ], "outputFiles": [ "results/FebControl1.vdjca" ], "version": "; built=Mon Sep 26 10:55:18 CEST 2022; rev=8c998df1ab; lib=repseqio.v2.0", "trimmingReport": null, "totalReadsProcessed": 584053, "aligned": 525390, "notAligned": 58663, "notAlignedReasons": { "VAndJOnDifferentTargets": 361, "NoBarcode": 0, "LowTotalScore": 0, "NoCDR3Parts": 0, "NoHits": 49276, "NoJHits": 6044, "NoVHits": 2982 }, "chimeras": 0, "overlapped": 509629, "alignmentAidedOverlaps": 22223, "overlappedAligned": 466857, "overlappedNotAligned": 42772, "pairedEndAlignmentConflicts": 42139, "vChimeras": 1154, "jChimeras": 2, "chainUsage": { "type": "chainUsage", "chimeras": 0, "total": 525390, "chains": { "IGH": { "total": 116697, "nonFunctional": 3925, "isOOF": 1803, "hasStops": 2122 }, "IGK": { "total": 203474, "nonFunctional": 8958, "isOOF": 8193, "hasStops": 765 }, "IGL": { "total": 205219, "nonFunctional": 11257, "isOOF": 9534, "hasStops": 1723 } } }, "realignedWithForcedNonFloatingBound": 193294, "realignedWithForcedNonFloatingRightBoundInLeftRead": 52153, "realignedWithForcedNonFloatingLeftBoundInRightRead": 52153, "noCDR3PartsAlignments": 89, "partialAlignments": 2659, "tagReport": { "type": "tagReport" } } { "type": "refineTagsAndSort", "commandLine": "--report results/FebControl1.refine.report.txt --json-report results/FebControl1.refine.report.json results/FebControl1.vdjca results/FebControl1.refined.vdjca", "inputFiles": [ "results/FebControl1.vdjca" ], "outputFiles": [ "results/FebControl1.refined.vdjca" ], "version": "; built=Mon Sep 26 10:55:18 CEST 2022; rev=8c998df1ab; lib=repseqio.v2.0", "correctionReport": { "inputRecords": 525390, "outputRecords": 487187, "steps": [ { "tagName": "UMI", "inputGroups": 1, "inputDiversity": 60939, "inputCount": 525390, "coreDiversity": 48831, "coreCount": 513049, "directlyCorrectedDiversity": 15939, "directlyCorrectedCount": 16711, "filteredDiversity": 3134, "filteredCount": 3151, "recursivelyCorrected": 878, "diversityFilteredByWhitelist": 0, "outputDiversity": 41866, "outputCount": 522239 } ], "filterReport": { "type": "filter_groups_report", "groupingKeys": [ "UMI" ], "numberOfGroups": 41866, "numberOfGroupsAccepted": 15113, "totalWeight": 522239, "totalWeightAccepted": 487187, "operatorReports": [ { "type": "generic_hist_report", "threshold": 6 } ], "metricHists": [ { "metric": { "type": "group_metric_sum_weight", "reportHist": { "log": true, "binNumber": 0, "minBinWidth": 0.2 } }, "hist": { "bins": [ { "from": 1, "to": 1.5848931924611136, "weight": 21923 }, { "from": 1.5848931924611136, "to": 2.51188643150958, "weight": 2805 }, { "from": 2.51188643150958, "to": 3.981071705534973, "weight": 988 }, { "from": 3.981071705534973, "to": 6.309573444801933, "weight": 1402 }, { "from": 6.309573444801933, "to": 10, "weight": 887 }, { "from": 10, "to": 15.848931924611142, "weight": 1763 }, { "from": 15.848931924611142, "to": 25.11886431509581, "weight": 3594 }, { "from": 25.11886431509581, "to": 39.810717055349734, "weight": 5109 }, { "from": 39.810717055349734, "to": 63.09573444801933, "weight": 2481 }, { "from": 63.09573444801933, "to": 100, "weight": 548 }, { "from": 100, "to": 158.48931924611142, "weight": 223 }, { "from": 158.48931924611142, "to": 251.18864315095823, "weight": 118 }, { "from": 251.18864315095823, "to": 398.1071705534973, "weight": 25 } ], "collectionSpec": { "log": true, "binNumber": 0, "minBinWidth": 0.2 } } } ] } } } { "type": "assemblerReport", "commandLine": "--report results/FebControl1.assemble.report.txt --json-report results/FebControl1.assemble.report.json results/FebControl1.refined.vdjca results/FebControl1.clns", "inputFiles": [ "results/FebControl1.refined.vdjca" ], "outputFiles": [ "results/FebControl1.clns" ], "version": "; built=Mon Sep 26 10:55:18 CEST 2022; rev=8c998df1ab; lib=repseqio.v2.0", "preCloneAssemblerReport": { "type": "preCloneAssemblerReport", "inputGroups": 15113, "inputAlignments": 487187, "clonotypes": 14993, "clonotypesPerGroup": { "0": 89, "1": 14965, "2": 14 }, "coreAlignments": 474527, "discardedCoreAlignments": 4683, "empiricallyAssignedAlignments": 5590, "vjEmpiricallyAssignedAlignments": 0, "umiEmpiricallyAssignedAlignments": 0, "gatEmpiricallyAssignedAlignments": 5590, "empiricalAssignmentConflicts": 0, "unassignedAlignments": 5618, "umiConflicts": 14, "gatConflicts": 8, "geneConflicts": { "Variable": 5, "Joining": 3 }, "coreClonotypesDroppedByTagSuffix": 0, "coreAlignmentsDroppedByTagSuffix": 0 }, "totalReadsProcessed": 584053, "initialClonesCreated": 8810, "readsDroppedNoTargetSequence": 7977, "readsDroppedTooShortClonalSequence": 0, "readsDroppedLowQuality": 0, "coreReads": 479850, "readsDroppedFailedMapping": 10, "lowQualityRescued": 43, "clonesClustered": 60, "readsClustered": 987, "clones": 8448, "clonesDroppedAsLowQuality": 3, "clonesPreClustered": 299, "readsPreClustered": 10879, "readsInClones": 478906, "readsInClonesBeforeClustering": 479893, "readsDroppedWithLowQualityClones": 214, "clonalChainUsage": { "type": "chainUsage", "chimeras": 0, "total": 8448, "chains": { "IGH": { "total": 1533, "nonFunctional": 43, "isOOF": 32, "hasStops": 11 }, "IGK": { "total": 3432, "nonFunctional": 209, "isOOF": 206, "hasStops": 3 }, "IGL": { "total": 3483, "nonFunctional": 233, "isOOF": 223, "hasStops": 10 } } } }